ydaJ

ydaJ
168

lipoprotein, may modify the extracellular polysaccharide synthesized by [protein|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]-[protein|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]-[protein|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]

locus
BSU_04270
Molecular weight
40.84 kDa
pI
4.9
Protein length
Gene length
function
unknown
product
lipoprotein
essential
no
synonyms
ydaJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
478,944  480,032
The protein
Protein family
glycosyl hydrolase 8 (GH8) family [Pubmed|27897378]
Structure
[PDB|3REN] (alpha-amylase from Clostridium perfringens, 25% identity) [pubmed|21905105]
[AF|O31486]
[wiki|Localization]
exported with N-terminal signal peptide, attached to the cell membrane (lipoprotein), faces towards the medium [Pubmed|27897378]
Expression and Regulation
Operons
genes
[gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]-[gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]-[gene|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]-[gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]-[gene|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]
description
[Pubmed|22383849]
regulation
expressed during stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]) [Pubmed|22383849]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|22383849], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]→[gene|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]

2022-12-01 23:42:44

Jstuelk

27

b605f66f599d67e539c67d5e096567c2b2e56ae4

80FCF67C03206CFA39A835FC21447D9DDEAF08EF

Biological materials
Mutant
MGNA-C073 (ydaJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2071 NBRP B. subtilis, Japan]
JH642 and its derivatives: natural deletion of the 18 kb [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH] region encompassing the genes [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|7D5327BD1DD5FD5F90B2C849589923AA3D8B20EF|topB]-[gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]-[gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]-[gene|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]-[gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]-[gene|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]-[gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]-[gene|6085BDAD40F719555EA4EEA7BBAD74103BD03D0F|mutT]-[gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]-[gene|87834D5C47064BEFF26F086A8202C311F28F9D38|ydzK]-[gene|search|mntH ][pubmed|18670626]
BKE04270 ([gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04270 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAGGCAAATCCCCCTTTG,  downstream forward: _UP4_CTGTTAGCCGAAAGGAAGCT
BKK04270 ([gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04270 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAGGCAAATCCCCCTTTG,  downstream forward: _UP4_CTGTTAGCCGAAAGGAAGCT
References
Reviews
28296273
Original Publications
22383849,27897378,21905105

69DEE29383E40F49890CC8314DFBF56D70D35113

Page visits: 2021

Time of last update: 2022-11-29 10:13:58

Author of last update: Bzhu