opuE
Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.

opuE
168

proline transporter

locus
BSU_06660
Molecular weight
53.12 kDa
pI
9.81
Protein length
Gene length
function
compatible solute transport
product
proline transporter
essential
no
synonyms
opuE, yerK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0591

This gene is a member of the following regulons

Gene
Coordinates
726,840  728,318
Phenotypes of a mutant
strong growth disadvantage in high-salinity minimal media lacking proline [Pubmed|22685134]
The protein
Protein family
[wiki|sodium:solute symporter (SSF) (TC 2.A.21) family] (according to UniProt)
Structure
[AF|O06493]
Paralogous protein(s)
[protein|B3DF99B747D0A7472E3878920BF3CE7CE954B0BE|putP]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|6A1F759DAC09D364602460E5467E2761E97CE45C|opuE]
description
[Pubmed|22383849]
regulation
induced by glucose ([protein|search|CcpA]) [Pubmed|22900538]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: activation, [Pubmed|22900538], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|9701821], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
additional information
the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
Open in new tab

[gene|6A1F759DAC09D364602460E5467E2761E97CE45C|opuE]

2022-04-30 14:04:21

ghost

20

4371b776c104e79e77889ccb95558d0e15e1e5fc

89417D1ED9EEFA62675D65EC2631C80FC5E615E8

Biological materials
Mutant
available in [wiki|Erhard Bremer]'s lab [Pubmed|24142252]
BKE06660 ([gene|6A1F759DAC09D364602460E5467E2761E97CE45C|opuE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06660 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGTTTTACCCTCTCTTCA,  downstream forward: _UP4_TAAGCAATAAGCCATCAAGC
BKK06660 ([gene|6A1F759DAC09D364602460E5467E2761E97CE45C|opuE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06660 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGTTTTACCCTCTCTTCA,  downstream forward: _UP4_TAAGCAATAAGCCATCAAGC
labs
[wiki|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi homepage]
References
Reviews
27935846
Original Publications
12884008,9701821,11902719,11902719,22685134,22900538,22383849,24142252,22139509,26728461

6A1F759DAC09D364602460E5467E2761E97CE45C

Page visits: 2639

Time of last update: 2022-08-18 15:23:32

Author of last update: Melvin.boenninger