SubtiWiki SubtiWiki
qdoI

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

qdoI
168

Fe-containing quercetin 2,3-dioxygenase

locus
BSU_39980
Molecular weight
37.43 kDa
pI
5.56
Protein length
Gene length
function
resistance to plant product quercetin
product
Fe-containing quercetin 2,3-dioxygenase
essential
no
synonyms
qdoI, yxaG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1917

This gene is a member of the following regulons

Gene
Coordinates
4,106,245  4,107,258
The protein
Catalyzed reaction/ biological activity
oxidation of the flavonol quercetin with dioxygen, cleaving the central heterocyclic ring and releasing CO
O2 + quercetin --> 2-(3,4-dihydroxybenzoyloxy)-4,6-dihydroxybenzoate + CO (according to UniProt)
Protein family
bicupin family
[wiki|Domains]
2 [wiki|cupin 2 domain]s (aa 55 ... 110, aa 226 ... 281)
[wiki|Cofactors]
Mn(II) (preferred), but also active with Fe(II) snd Co(II) [Pubmed|22084064]
Structure
[PDB|1Y3T] [Pubmed|15628860]
[PDB|2H0V]
Expression and Regulation
Operons
genes
[gene|6A68EF7BF16FC2F2C7E068F52901EF2BFD6EBF8A|qdoI]-[gene|142444E1167BA7428EB95E4418C839ADF3E728B0|yxaH]
description
[Pubmed|10746760]
regulation
induced by flavonoids such as quercetin ([protein|search|QdoR], [protein|search|LmrA]) [Pubmed|17483215]
regulatory mechanism
[protein|52D560AA02F0849CB24460A496021560063B2E12|lmrA]: repression, [Pubmed|15317768], in [regulon|protein:52D560AA02F0849CB24460A496021560063B2E12|lmrA regulon]
[protein|47387014B5E89BF218BA94D8C2A570479B1EFD4E|qdoR]: repression, [Pubmed|17483215], in [regulon|protein:47387014B5E89BF218BA94D8C2A570479B1EFD4E|qdoR regulon]
additional information
major regulator: [protein|search|QdoR] [PubMed|17483215]
Open in new tab

[gene|6A68EF7BF16FC2F2C7E068F52901EF2BFD6EBF8A|qdoI]→[gene|142444E1167BA7428EB95E4418C839ADF3E728B0|yxaH]

2021-11-13 11:33:34

ghost

7

c14e762fec9f4cbec17fdbace8ff20295b9c49d0

C80841584C27E4DC50FE3CA20B59B16E53149C1B

Biological materials
Mutant
MGNA-B684 (yxaG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1683 NBRP B. subtilis, Japan]
BKE39980 ([gene|6A68EF7BF16FC2F2C7E068F52901EF2BFD6EBF8A|qdoI]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39980 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTATCGCTTCCTCCAA,  downstream forward: _UP4_TAAAGATGACAAGATTGTAA
BKK39980 ([gene|6A68EF7BF16FC2F2C7E068F52901EF2BFD6EBF8A|qdoI]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39980 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTATCGCTTCCTCCAA,  downstream forward: _UP4_TAAAGATGACAAGATTGTAA
References
Reviews
9056848,10730195
Original Publications
17483215,14741339,15039076,15317768,10746760,20460727,14697267,22084064,16411777,27170159,15628860

6A68EF7BF16FC2F2C7E068F52901EF2BFD6EBF8A

Page visits: 1017

Time of last update: 2022-01-18 10:15:20

Author of last update: Melvin.boenninger