qdoI

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

qdoI
168

Fe-containing quercetin 2,3-dioxygenase

locus
BSU_39980
Molecular weight
37.43 kDa
pI
5.56
Protein length
Gene length
function
resistance to plant product quercetin
product
Fe-containing quercetin 2,3-dioxygenase
essential
no
synonyms
qdoI, yxaG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1917

This gene is a member of the following regulons

Gene
Coordinates
4,106,245  4,107,258
The protein
Catalyzed reaction/ biological activity
oxidation of the flavonol quercetin with dioxygen, cleaving the central heterocyclic ring and releasing CO
O2 + quercetin --> 2-(3,4-dihydroxybenzoyloxy)-4,6-dihydroxybenzoate + CO (according to UniProt)
Protein family
bicupin family
[wiki|Domains]
2 [wiki|cupin 2 domain]s (aa 55 ... 110, aa 226 ... 281)
[wiki|Cofactors]
Mn(II) (preferred), but also active with Fe(II) snd Co(II) [Pubmed|22084064]
Structure
[PDB|1Y3T] [Pubmed|15628860]
[PDB|2H0V]
[AF|P42106]
Expression and Regulation
Operons
genes
[gene|6A68EF7BF16FC2F2C7E068F52901EF2BFD6EBF8A|qdoI]-[gene|142444E1167BA7428EB95E4418C839ADF3E728B0|yxaH]
description
[Pubmed|10746760]
regulation
induced by flavonoids such as quercetin ([protein|search|QdoR], [protein|search|LmrA]) [Pubmed|17483215]
regulatory mechanism
[protein|52D560AA02F0849CB24460A496021560063B2E12|lmrA]: repression, [Pubmed|15317768], in [regulon|protein:52D560AA02F0849CB24460A496021560063B2E12|lmrA regulon]
[protein|47387014B5E89BF218BA94D8C2A570479B1EFD4E|qdoR]: repression, [Pubmed|17483215], in [regulon|protein:47387014B5E89BF218BA94D8C2A570479B1EFD4E|qdoR regulon]
additional information
major regulator: [protein|search|QdoR] [PubMed|17483215]
Open in new tab

[gene|6A68EF7BF16FC2F2C7E068F52901EF2BFD6EBF8A|qdoI]→[gene|142444E1167BA7428EB95E4418C839ADF3E728B0|yxaH]

2022-04-30 18:29:18

ghost

11

c14e762fec9f4cbec17fdbace8ff20295b9c49d0

C80841584C27E4DC50FE3CA20B59B16E53149C1B

Biological materials
Mutant
MGNA-B684 (yxaG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1683 NBRP B. subtilis, Japan]
BKE39980 ([gene|6A68EF7BF16FC2F2C7E068F52901EF2BFD6EBF8A|qdoI]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39980 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTATCGCTTCCTCCAA,  downstream forward: _UP4_TAAAGATGACAAGATTGTAA
BKK39980 ([gene|6A68EF7BF16FC2F2C7E068F52901EF2BFD6EBF8A|qdoI]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39980 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTATCGCTTCCTCCAA,  downstream forward: _UP4_TAAAGATGACAAGATTGTAA
References
Reviews
9056848,10730195
Original Publications
17483215,14741339,15039076,15317768,10746760,20460727,14697267,22084064,16411777,27170159,15628860

6A68EF7BF16FC2F2C7E068F52901EF2BFD6EBF8A

Page visits: 1116

Time of last update: 2022-05-18 08:08:16

Author of last update: Melvin.boenninger