remA

remA
168

transcriptional regulator of the extracellular matrix genes, acts in parallel to [protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR], [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB], and [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]

locus
BSU_15670
Molecular weight
9.71 kDa
pI
7.18
Protein length
Gene length
function
control of biofilm formation
product
regulator of the extracellular matrix genes
essential
no
ec
null
synonyms
remA, ylzA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2052

This gene is a member of the following regulons

Gene
Coordinates
1,641,672  1,641,941
The protein
Catalyzed reaction/ biological activity
binds [gene|FB2220730013A98D7C979062A4A451518B92DF09|opuAA], [gene|8C13E1EF5437DD8F9906643DEDCBB18DABE3B9E3|tapA], and [gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA] promoter regions (upstream of the actual promoter) to activate transcription [Pubmed|23646920]
binds DNA with high co-operativity due to low conserrvation of binding sites [Pubmed|23646920]
Protein family
RemA family (single member, according to UniProt)
Structure
[PDB|7BM2] [pubmed|34588455]
[AF|Q7WY72]
Expression and Regulation
Operons
genes
[gene|A57D2C1536F3E93CD687C28C59FF297355CAB303|yloC]-[gene|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]-[gene|1BC994DE60A7BB35DEDD7154581A396D29AA94A7|gmk]-[gene|921933B6B893083F151AABDEDCBC65F2E55677BE|yloH]
description
[pubmed|22383849]
regulation
expressed during vegetative growth and early during sporulation in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]) [Pubmed|23396918]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|23396918], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
Open in new tab

[gene|A57D2C1536F3E93CD687C28C59FF297355CAB303|yloC]->[gene|921933B6B893083F151AABDEDCBC65F2E55677BE|yloH]

2022-11-22 02:07:57

Bzhu

41

b4ed2f235ea58a2cb7be55cafee822b895fe00c8

099190FEE74E539BB75FE227F5793536D7B467E8

genes
[gene|A57D2C1536F3E93CD687C28C59FF297355CAB303|yloC]-[gene|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]-[gene|1BC994DE60A7BB35DEDD7154581A396D29AA94A7|gmk]-[gene|921933B6B893083F151AABDEDCBC65F2E55677BE|yloH]-[gene|2B67C63442F28F6BCBA3BA6DE4B563C73E8DF16C|yloI]-[gene|AF5ADDA2A98EC18BB72A81AA0336E639C0D1F430|priA]-[gene|3D41FB608DB70B9482312A1BBCCDBDA7FB713AFA|defA]-[gene|06971E9AAB033E2878914A76645F99E97CE8A90A|fmt]-[gene|1370D8783450D538C71E3DE8EA5B37DFEE073FF0|yloM]-[gene|5DEBD84E5937DB8B7F29C729FAA0076DF86A5451|yloN]
description
[pubmed|22383849]
Open in new tab

[gene|A57D2C1536F3E93CD687C28C59FF297355CAB303|yloC]->[gene|5DEBD84E5937DB8B7F29C729FAA0076DF86A5451|yloN]

2022-11-19 09:19:17

Jstuelk

46

67080d1e476b4c1544f46abe5db9b45c3ccd93f3

2C39B75EDCD294B0CAC1DECB4007285A35FDAE1D

genes
[gene|7821A09DADC6EAF589A882F05CC34BE900E06F2A|yloB]-[gene|A57D2C1536F3E93CD687C28C59FF297355CAB303|yloC]-[gene|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]-[gene|1BC994DE60A7BB35DEDD7154581A396D29AA94A7|gmk]-[gene|921933B6B893083F151AABDEDCBC65F2E55677BE|yloH]
description
[pubmed|22383849]
regulation
expressed during sporulation in the mother cell [pubmed|12161109]
Open in new tab

[gene|7821A09DADC6EAF589A882F05CC34BE900E06F2A|yloB]->[gene|921933B6B893083F151AABDEDCBC65F2E55677BE|yloH]

2022-11-22 23:30:59

Jstuelk

47

b15c1f28629d3e15db14719be44c291dd5f28c5f

86CE620BD4E14CC259270F542702B302B7837CCD

Biological materials
Mutant
BKE15670 ([gene|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE15670 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTCTACGTTCCCCCTG,  downstream forward: _UP4_GATGAAGGGCAGGGGTAATT
BKK15670 ([gene|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK15670 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTCTACGTTCCCCCTG,  downstream forward: _UP4_GATGAAGGGCAGGGGTAATT
labs
[wiki|Daniel Kearns], Indiana University, Bloomington, USA, [http://www.bio.indiana.edu/facultyresearch/faculty/Kearns.html homepage]
References
Reviews
24988880,35289951
Original Publications
19363116,22329926,23123912,23396918,23646920,25035996,34588455

6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799

Page visits: 3464

Time of last update: 2022-11-26 11:27:15

Author of last update: Jstuelk