ydeR

ydeR
168

similar to antibiotic resistance protein

locus
BSU_05310
Molecular weight
40.99 kDa
pI
10.76
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ydeR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2814

This gene is a member of the following regulons

Gene
Coordinates
576,946  578,133
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
Structure
[AF|P96675]
[wiki|Localization]
cell membrane (according to UniProt)
Biological materials
Mutant
MGNA-C139 (ydeR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2137 NBRP B. subtilis, Japan]
BKE05310 ([gene|6B11EE4269A2CFF8A37C63FA41EA6BAD2727D0A4|ydeR]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE05310 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGAATGAACTCCTTTT,  downstream forward: _UP4_TAAGTATTTCACCAAAAATA
BKK05310 ([gene|6B11EE4269A2CFF8A37C63FA41EA6BAD2727D0A4|ydeR]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK05310 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGAATGAACTCCTTTT,  downstream forward: _UP4_TAAGTATTTCACCAAAAATA

6B11EE4269A2CFF8A37C63FA41EA6BAD2727D0A4

Page visits: 970

Time of last update: 2022-12-04 04:33:38

Author of last update: Melvin.boenninger