yocD

yocD
168

similar to immunity to bacteriotoxins

locus
BSU_19170
Molecular weight
36.25 kDa
pI
5.58
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yocD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1619

This gene is a member of the following regulons

Gene
Coordinates
2,088,257  2,089,234
The protein
Protein family
peptidase S66 family (with [protein|C4F85F85F0C99A59145961E34B19D3AD03D2BC22|ykfA], according to UniProt)
Structure
[PDB|3SR3] (MccF from ''B. anthracis'', 33% identity, 66% similarity)
[AF|O35046]
Expression and Regulation
Operons
genes
[gene|CF8F38491E7DBDE77899D47E133B84DBB37C262C|yocC]-[gene|6B36C3B0FA04FBCB20C2C9AEA987DDD211E29629|yocD]
description
[Pubmed|22383849]
Open in new tab

[gene|CF8F38491E7DBDE77899D47E133B84DBB37C262C|yocC]→[gene|6B36C3B0FA04FBCB20C2C9AEA987DDD211E29629|yocD]

2022-11-13 17:14:40

Jstuelk

19

248b4111f479830b927a9fe39ee72f36f599072b

78FB85CC53240CE12B3EAC895D7122F2827CF6DD

genes
[gene|6B36C3B0FA04FBCB20C2C9AEA987DDD211E29629|yocD]
description
[pubmed|22383849]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
Open in new tab

[gene|6B36C3B0FA04FBCB20C2C9AEA987DDD211E29629|yocD]

2022-11-19 18:21:18

Bzhu

15

fd834e674f1b7d6031b3ba46da2d99047fa1e876

88D0EFF2B434EE1B20CFAFAF117247A5F596D863

Biological materials
Mutant
MGNA-B413 (yocD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1412 NBRP B. subtilis, Japan]
BKE19170 ([gene|6B36C3B0FA04FBCB20C2C9AEA987DDD211E29629|yocD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE19170 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGAACCCTCCATCAATG,  downstream forward: _UP4_TAATCAGCTTGTAAATTTTT
BKK19170 ([gene|6B36C3B0FA04FBCB20C2C9AEA987DDD211E29629|yocD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK19170 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGAACCCTCCATCAATG,  downstream forward: _UP4_TAATCAGCTTGTAAATTTTT
References
20817675

6B36C3B0FA04FBCB20C2C9AEA987DDD211E29629

Page visits: 1129

Time of last update: 2022-11-26 11:40:36

Author of last update: Melvin.boenninger