ykoS

ykoS
168

unknown

locus
BSU_13380
Molecular weight
66.33 kDa
pI
9.76
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ykoS, ykoR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,401,772  1,403,466
The protein
Structure
[AF|O34830]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|6B66E6E138ED70318E5911F310953D8F09FA8719|ykoS]-[gene|EF18470AD2B07755431534B52A8FCE6754FDBA9D|ykoT]
description
[Pubmed|22383849]
regulation
expressed late during [wiki|sporulation] in the forespore ([wiki|SigG], [wiki|SpoVT]) [Pubmed|26577401]
regulatory mechanism
[protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]: repression, [Pubmed|26577401], in [regulon|protein:01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT regulon]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|26577401], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|6B66E6E138ED70318E5911F310953D8F09FA8719|ykoS]→[gene|EF18470AD2B07755431534B52A8FCE6754FDBA9D|ykoT]

2023-01-21 23:09:47

ghost

164

3278536c2bae558d0e5cbe5926c55a6028787f3a

2C73474FD5BDF1C29496BC0E6A0016FF67BCD1D0

Biological materials
Mutant
MGNA-A763 (ykoS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/763 NBRP B. subtilis, Japan]
BKE13380 ([gene|6B66E6E138ED70318E5911F310953D8F09FA8719|ykoS]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE13380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTACACATCCATTT,  downstream forward: _UP4_GAAACAAGATAAGGAGGATA
BKK13380 ([gene|6B66E6E138ED70318E5911F310953D8F09FA8719|ykoS]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK13380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTACACATCCATTT,  downstream forward: _UP4_GAAACAAGATAAGGAGGATA
References
22383849,26577401

6B66E6E138ED70318E5911F310953D8F09FA8719

Page visits: 1407

Time of last update: 2023-02-02 04:56:23

Author of last update: Jstuelk