bpsB

bpsB
168

methyltransferase, involved in polyketide synthesis

locus
BSU_22040
Molecular weight
19.17 kDa
pI
9.55
Protein length
Gene length
function
polyketide synthesis
product
methyltransferase
essential
no
ec
null
synonyms
bpsB, ypbQ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1755

This gene is a member of the following regulons

Gene
Coordinates
2,316,446  2,316,952
The protein
Catalyzed reaction/ biological activity
conversion of triketide pyrones to alkylpyrone methyl ethers [Pubmed|19465653]
Structure
[AF|P54158]
Expression and Regulation
Operons
genes
[gene|7D90F7AF49BAD6A95731BF805991DEBBBCAFA46C|bpsA]-[gene|6BAF5763249305F27326F941A34956396B3F8C99|bpsB]
description
[Pubmed|19465653]
Open in new tab

[gene|7D90F7AF49BAD6A95731BF805991DEBBBCAFA46C|bpsA]→[gene|6BAF5763249305F27326F941A34956396B3F8C99|bpsB]

2022-11-26 11:11:38

ghost

17

8889bdbb47d5cd3070f477acb378e4900fe1a36a

9E921FCD7E68BD3C0070A5633C1B3121483061F8

Biological materials
Mutant
MGNA-A876 (ypbQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/876 NBRP B. subtilis, Japan]
BKE22040 ([gene|6BAF5763249305F27326F941A34956396B3F8C99|bpsB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE22040 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GGCGATCAACAACCAAAACA,  downstream forward: _UP4_TAGCGATTGAAAATCATTCT
BKK22040 ([gene|6BAF5763249305F27326F941A34956396B3F8C99|bpsB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK22040 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GGCGATCAACAACCAAAACA,  downstream forward: _UP4_TAGCGATTGAAAATCATTCT
References
19465653,20525796

6BAF5763249305F27326F941A34956396B3F8C99

Page visits: 1449

Time of last update: 2022-11-27 12:17:26

Author of last update: Bzhu