cah

cah
168

cephalosporin C deacetylase

locus
BSU_03180
Molecular weight
35.65 kDa
pI
5.42
Protein length
Gene length
function
resistance to cephalosporin C
product
cephalosporin C deacetylase)
essential
no
ec
3.1.1.41
synonyms
cah

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3458

This gene is a member of the following regulons

Gene
Coordinates
342,538  343,494
The protein
Catalyzed reaction/ biological activity
cephalosporin C + H2O --> acetate + deacetylcephalosporin C + H+ (according to UniProt)
Protein family
carbohydrate esterase 7 family (single member, according to UniProt)
Structure
[PDB|1ODS] [pubmed|12842474]
[AF|P94388]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|6BCE78F623A40B519211E79AFA1AD898318BD817|cah]
description
[Pubmed|7793942]
Open in new tab

[gene|6BCE78F623A40B519211E79AFA1AD898318BD817|cah]

2022-11-24 08:04:08

ghost

13

46b1368ad1cd04bb9d87f7bbc3b755755eb00690

76F65BAC4D0FEBD2822136E5D7F9FD61492B947F

genes
[gene|D28190620D5B834DD7F42822B835C6FE932FD8A5|ycgK]-[gene|6BCE78F623A40B519211E79AFA1AD898318BD817|cah]-[gene|7306A55192AEB4032FD17A1BAAFF1127D511D70E|ycgL]
description
[Pubmed|22383849]
Open in new tab

[gene|D28190620D5B834DD7F42822B835C6FE932FD8A5|ycgK]→[gene|7306A55192AEB4032FD17A1BAAFF1127D511D70E|ycgL]

2022-11-25 20:30:44

Jstuelk

29

ab6bd4636d1fc5110090b1b0ce77491e89fa4b6d

B23BDB1B6636DD3E6BBB58391EB252FE951AC9F0

Biological materials
Mutant
BKE03180 ([gene|6BCE78F623A40B519211E79AFA1AD898318BD817|cah]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03180 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCCGATTATTCCCCTT,  downstream forward: _UP4_TGATAAATGTGAAAAGCCGC
BKK03180 ([gene|6BCE78F623A40B519211E79AFA1AD898318BD817|cah]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03180 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCCGATTATTCCCCTT,  downstream forward: _UP4_TGATAAATGTGAAAAGCCGC
References
12842474,7793942,15069587,16232499,12842474

6BCE78F623A40B519211E79AFA1AD898318BD817

Page visits: 2199

Time of last update: 2022-11-27 09:16:11

Author of last update: Melvin.boenninger