sspP

sspP
168

probable small acid-soluble spore protein (minor)

locus
BSU_17980
Molecular weight
5.30 kDa
pI
10.99
Protein length
Gene length
function
protection of spore DNA
product
probable small acid-soluble spore protein (minor)
essential
no
synonyms
sspP, cotL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5861

This gene is a member of the following regulons

Gene
Coordinates
1,926,128  1,926,274
The protein
Protein family
sspP family (single member, according to UniProt)
Structure
[AF|P71032]
[wiki|Localization]
spore core (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|174047392BCCE4D57528ED78866626252BBF10D2|sspO]-[gene|6C0BA5B55EE5CF737C4E263BFFF760374054C6AE|sspP]
description
[Pubmed|10806362]
regulation
expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|10806362]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|10806362], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|174047392BCCE4D57528ED78866626252BBF10D2|sspO]→[gene|6C0BA5B55EE5CF737C4E263BFFF760374054C6AE|sspP]

2022-12-24 04:07:18

ghost

19

9afd3a72c2e33c0f42a11caea9ee31e623183715

263B586BE30D228063DC840EDC6C014469AB25A4

additional information
the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
Biological materials
Mutant
BKE17980 ([gene|6C0BA5B55EE5CF737C4E263BFFF760374054C6AE|sspP]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE17980 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAATGAGAACCTCCTT,  downstream forward: _UP4_TAAGAAAAGCAGACCTTAGT
BKK17980 ([gene|6C0BA5B55EE5CF737C4E263BFFF760374054C6AE|sspP]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK17980 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAATGAGAACCTCCTT,  downstream forward: _UP4_TAAGAAAAGCAGACCTTAGT
References
10806362,30782632

6C0BA5B55EE5CF737C4E263BFFF760374054C6AE

Page visits: 1097

Time of last update: 2023-01-30 23:17:47

Author of last update: Melvin.boenninger