SubtiWiki SubtiWiki
yybA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yybA
168

similar to transcriptional regulator ([wiki|MarR family])

locus
BSU_40710
Molecular weight
17.44 kDa
pI
9.81
Protein length
Gene length
function
unknown
product
transcriptional regulator ([wiki|MarR family])
essential
no
synonyms
yybA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1846

This gene is a member of the following regulons

Gene
Coordinates
4,183,445  4,183,897
The protein
[wiki|Domains]
[wiki|HTH marR-type domain] (aa 1-133) (according to UniProt)
Structure
[PDB|1LJ9] (SlyA from Enterococcus faecalis, 69% identity) [pubmed|12649270]
Biological materials
Mutant
MGNA-B853 (yybA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1852 NBRP B. subtilis, Japan]
BKE40710 ([gene|6C48D8865633A04AA6266A0FACDC25840282A5F2|yybA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40710 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCCTAAAACCCCTCACG,  downstream forward: _UP4_TAATGGACAACGTTAACAAG
BKK40710 ([gene|6C48D8865633A04AA6266A0FACDC25840282A5F2|yybA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40710 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCCTAAAACCCCTCACG,  downstream forward: _UP4_TAATGGACAACGTTAACAAG
References
Research papers
12649270

6C48D8865633A04AA6266A0FACDC25840282A5F2

Page visits: 719

Time of last update: 2021-11-17 21:51:56

Author of last update: Melvin.boenninger