yobQ
Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.

yobQ
168

similar to transcription factor ([wiki|AraC family])

locus
BSU_19050
Molecular weight
28.11 kDa
pI
8.48
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yobQ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2207

This gene is a member of the following regulons

Gene
Coordinates
2,079,611  2,080,336
The protein
Protein family
[wiki|AraC family]
[wiki|Domains]
[wiki|cupin 2 domain] (aa 22 ... 78)
[wiki|HTH araC/xylS-type domain] (aa 137-235) (according to UniProt)
Structure
[AF|O34901]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|EDD0C5732E487A7F94684289F59B9130773316C1|yobT]-[gene|BB122C73972ACEA08DE97F95FC9AC249671C86A3|yobS]-[gene|6D9AAA63C4E43D2F80C7A2104BDF4D98A21C3B78|yobR]-[gene|6C67AD722D59671ED7589949690773732A8B845F|yobQ]-[gene|DA4A64BDF322EDE9EECE83AC9D4AAA01D3F16720|csaA]
description
[pubmed|22383849]
Open in new tab

[gene|EDD0C5732E487A7F94684289F59B9130773316C1|yobT]→[gene|DA4A64BDF322EDE9EECE83AC9D4AAA01D3F16720|csaA]

2022-07-13 00:41:03

Jstuelk

18

6e2fc48cd9351e255e253378071ece95cfb0f322

150BFC611EEBBD8FF04DFD029529866364003186

genes
[gene|6D9AAA63C4E43D2F80C7A2104BDF4D98A21C3B78|yobR]-[gene|6C67AD722D59671ED7589949690773732A8B845F|yobQ]-[gene|DA4A64BDF322EDE9EECE83AC9D4AAA01D3F16720|csaA]
description
[pubmed|22383849]
Open in new tab

[gene|6D9AAA63C4E43D2F80C7A2104BDF4D98A21C3B78|yobR]→[gene|DA4A64BDF322EDE9EECE83AC9D4AAA01D3F16720|csaA]

2022-06-13 05:36:54

Jstuelk

15

01d25ecbae857bab54a574212ebdb6f5f88819d6

543E31AC0CC12F8F549BBE5982B66B8DCBA15154

Biological materials
Mutant
MGNA-A313 (yobQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/313 NBRP B. subtilis, Japan]
BKE19050 ([gene|6C67AD722D59671ED7589949690773732A8B845F|yobQ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19050 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTAGCAAACCCCTTCCTT,  downstream forward: _UP4_TGATGGCTCTTTAGTTAAAA
BKK19050 ([gene|6C67AD722D59671ED7589949690773732A8B845F|yobQ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19050 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTAGCAAACCCCTTCCTT,  downstream forward: _UP4_TGATGGCTCTTTAGTTAAAA
References
23504016

6C67AD722D59671ED7589949690773732A8B845F

Page visits: 844

Time of last update: 2022-08-15 02:14:30

Author of last update: Melvin.boenninger