spoIISB

spoIISB
168

disruption blocks sporulation after septum formation

locus
BSU_12820
Molecular weight
6.52 kDa
pI
10.79
Protein length
Gene length
function
sporulation
product
anti-toxin
essential
no
synonyms
spoIISB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,348,442  1,348,612
Phenotypes of a mutant
sporulation efficiency is reduced by four orders of magnitude  [Pubmed|11371520]
The protein
Protein family
SpoIISB antitoxin family (single member, according to UniProt)
Structure
[PDB|3O6Q] (cytoplasmic fragment of [protein|CD14C88E9976964A0D25BAA22C395A5A6951654D|spoIISA] (CSpoIISA) in complex with [protein|6C9F403D67CDC2EE66C534B0F23D973E24C9A089|spoIISB]) [Pubmed|21147767]
[AF|O34800]
Expression and Regulation
Operons
genes
[gene|CD14C88E9976964A0D25BAA22C395A5A6951654D|spoIISA]-[gene|6C9F403D67CDC2EE66C534B0F23D973E24C9A089|spoIISB]
description
[Pubmed|11371520]
sigma factors
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
Open in new tab

[gene|CD14C88E9976964A0D25BAA22C395A5A6951654D|spoIISA]→[gene|6C9F403D67CDC2EE66C534B0F23D973E24C9A089|spoIISB]

2022-11-22 13:03:54

ghost

32

dba0540459879cc4ec595c8048a437eb0a18061d

5789610C653201DDB59376F461D88F12DF191D72

Biological materials
Mutant
1S124 ( ''spoIISB''::''tet''), [Pubmed|11371520], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S124&Search=1S124 BGSC]
BKE12820 ([gene|6C9F403D67CDC2EE66C534B0F23D973E24C9A089|spoIISB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE12820 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCTGTTTTGAAACGCACGTT,  downstream forward: _UP4_TGATCACACTAAAAGGACAA
BKK12820 ([gene|6C9F403D67CDC2EE66C534B0F23D973E24C9A089|spoIISB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK12820 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCTGTTTTGAAACGCACGTT,  downstream forward: _UP4_TGATCACACTAAAAGGACAA
References
18096016,11371520,26300872,21147767,27294956

6C9F403D67CDC2EE66C534B0F23D973E24C9A089

Page visits: 1559

Time of last update: 2022-11-29 05:10:35

Author of last update: Melvin.boenninger