nagR

nagR
168

transcriptional regulator ([wiki|GntR family])

locus
BSU_35030
Molecular weight
27.36 kDa
pI
6.77
Protein length
Gene length
function
regulator of the [gene|8F4D075C9B9EF995E361F9BA5E8B52F42059C422|nagA]-[gene|0C8D7EAC2656E989E45B5B7E42FAA6D258956B56|nagB]-[gene|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR] operon
product
transcriptional regulator ([wiki|GntR family])
essential
no
synonyms
nagR, yvoA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2188

This gene is a member of the following regulons

Gene
Coordinates
3,597,289  3,598,020
The protein
Catalyzed reaction/ biological activity
transcription repression of ''[gene|7D5A8084FDDA962CCF028FC3735E68C4F2E77084|nagP]'' and of the putative ''[gene|8F4D075C9B9EF995E361F9BA5E8B52F42059C422|nagA]-[gene|0C8D7EAC2656E989E45B5B7E42FAA6D258956B56|nagB]-[gene|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR]'' operon in the absence of N-acetylglycosamine [Pubmed|24673833,20047956,21602348], weak repression of ''[gene|F2DE9BFE16D7B0DAE92DB58F9B1EDFBB7557ED16|yflG]'' [Pubmed|16207374]
Protein family
[wiki|GntR family] of transcription factors
[wiki|Domains]
[wiki|HTH gntR-type domain] (aa 9-77) (according to UniProt)
Structure
[PDB|2WV0] [Pubmed|20047956]
[PDB|4U0V] (complex with glucosamine-6-phosphate) [Pubmed|25564531]
[PDB|4U0W] (complex with N-acetylglucosamine-6-phosphate) [Pubmed|25564531]
[PDB|4WWC] (complex with palindromic operator DNA) [Pubmed|25564531]
[AF|O34817]
Effectors of protein activity
N-acetylglucosamine-6-phosphate and glucosamine-6-phosphate act as the molecular inducers [Pubmed|25564531,21602348,20047956]
Kinetic information
K(D) for N-acetylglucosamine-6-phosphate: 1 mM [Pubmed|20047956]
Expression and Regulation
Operons
genes
[gene|8F4D075C9B9EF995E361F9BA5E8B52F42059C422|nagA]-[gene|0C8D7EAC2656E989E45B5B7E42FAA6D258956B56|nagB]-[gene|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR]
description
[Pubmed|21602348]
regulation
induced in the presence of N-acetylglucosamine ([protein|search|NagR]) [Pubmed|24673833,21602348,14343123]
regulatory mechanism
[protein|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR]: repression, [Pubmed|24673833,21602348], in [regulon|protein:6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|12850135], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|23667565], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|8F4D075C9B9EF995E361F9BA5E8B52F42059C422|nagA]→[gene|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR]

2022-11-26 05:24:36

ghost

25

dfb9f60c6cb4712882f6e111396691335972d607

2CE10C0E65E696F5F9B1AAC17ED9D19E163A6ECF

Biological materials
Mutant
MGNA-A335 (yvoA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/335 NBRP B. subtilis, Japan]
BKE35030 ([gene|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE35030 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAGTCAGCATGTTCCTT,  downstream forward: _UP4_TCATAAAAAAAGCCTCCAAC
BKK35030 ([gene|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK35030 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAGTCAGCATGTTCCTT,  downstream forward: _UP4_TCATAAAAAAAGCCTCCAAC
References
Reviews
26159076
Original Publications
19342794,20047956,16207374,21602348,23667565,24673833,25564531,30254611

6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5

Page visits: 2897

Time of last update: 2022-11-29 20:25:20

Author of last update: Melvin.boenninger