yrhH

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

yrhH
168

similar to methyltransferase

locus
BSU_27180
Molecular weight
20.99 kDa
pI
10.16
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yrhH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2226

This gene is a member of the following regulons

Gene
Coordinates
2,777,877  2,778,419
The protein
Protein family
[wiki|Methyltransferase superfamily] (according to UniProt)
Structure
[AF|O05400]
Expression and Regulation
Operons
genes
[gene|6D5089931FBDB398A7FAF3C8DDF341EB4949AEFE|yrhH]
description
[Pubmed|9683469]
regulation
Expressed under stress conditions ([protein|search|SigW], [protein|search|SigX]) [Pubmed|9683469]
sigma factors
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|9683469], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
[protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]: sigma factor, [Pubmed|9683469], in [regulon|protein:E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX regulon]
additional information
the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
Open in new tab

[gene|6D5089931FBDB398A7FAF3C8DDF341EB4949AEFE|yrhH]

2022-04-08 07:41:50

ghost

5

27a0b18a4d979b0c89477f7b85c063f0861d2071

1F086AF668F71BA554469512C2383C4786A2CA04

genes
[gene|6D5089931FBDB398A7FAF3C8DDF341EB4949AEFE|yrhH]-[gene|3DA3FFB295F5513A220CB163994EE0F356C810E6|fatR]-[gene|4BA5214C441C6671CB7DAA3CACBCA5FC025BE0E6|yrhJ]
description
[Pubmed|18179421]
regulation
Expressed under stress conditions ([protein|search|SigW], [protein|search|SigX]) [Pubmed|9683469]
additional information
A [protein|search|ncRNA] ([wiki|RnaC]) is encoded between '[protein|search|yrhK]' and '[protein|search|yrhJ]' [PubMed|25790031]
Open in new tab

[gene|6D5089931FBDB398A7FAF3C8DDF341EB4949AEFE|yrhH]→[gene|4BA5214C441C6671CB7DAA3CACBCA5FC025BE0E6|yrhJ]

2022-05-16 05:38:21

ghost

11

6a319165d87b6e310ceee6802fc5be1260c7635a

96207AF27502FF7704502BDB88571F1FEBAA2D56

Biological materials
Mutant
BKE27180 ([gene|6D5089931FBDB398A7FAF3C8DDF341EB4949AEFE|yrhH]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27180 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTAAACACCTGCTTTT,  downstream forward: _UP4_TAAAAAATTTCTCGGGAAAT
BKK27180 ([gene|6D5089931FBDB398A7FAF3C8DDF341EB4949AEFE|yrhH]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27180 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTAAACACCTGCTTTT,  downstream forward: _UP4_TAAAAAATTTCTCGGGAAAT
References
21926231,9683469,18179421,21815947

6D5089931FBDB398A7FAF3C8DDF341EB4949AEFE

Page visits: 2760

Time of last update: 2022-05-26 12:05:20

Author of last update: Jstuelk