czcO

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

czcO
168

similar to flavin-containing monooxygenase, facilitates cation export via [protein|7FB5BCC16D688465A820F436F657C49625257884|czcD]

locus
BSU_26640
Molecular weight
38.91 kDa
pI
9.83
Protein length
Gene length
function
resistance to toxic metal ions
product
unknown
essential
no
synonyms
czcO, trkA, yrdP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2072

This gene is a member of the following regulons

Gene
Coordinates
2,722,767  2,723,804
The protein
Structure
[PDB|4USQ] (from Cellvibrio sp., 23% identity) [pubmed|25383040]
[AF|O07085]
Expression and Regulation
Operons
genes
[gene|7FB5BCC16D688465A820F436F657C49625257884|czcD]-[gene|6D6C324675631B5CAB165D6DF72AA45BF3DB6F29|czcO]
description
[Pubmed|15948947]
regulation
induced in the presence of toxic metal ions (Zn(II), Cd(II), Co(II), Ni(II) and Cu(II)) ([protein|search|CzrA]) [Pubmed|15948947]
regulatory mechanism
[protein|6FB1865734C4DE7BE19D3D1A7E0C687B6D7094E1|czrA]: repression, [Pubmed|15948947], in [regulon|protein:6FB1865734C4DE7BE19D3D1A7E0C687B6D7094E1|czrA regulon]
Open in new tab

[gene|7FB5BCC16D688465A820F436F657C49625257884|czcD]→[gene|6D6C324675631B5CAB165D6DF72AA45BF3DB6F29|czcO]

2022-01-24 21:07:59

ghost

8

430ab856fd55b6eef5935b0d08aeb7c4ec8a07ad

CA86623CDC188C345091326FF4E65FA2529C0CB9

Biological materials
Mutant
BKE26640 ([gene|6D6C324675631B5CAB165D6DF72AA45BF3DB6F29|czcO]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26640 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACATTATCACCCCGCCAAT,  downstream forward: _UP4_TAAACGAAGCAGAGCAGTAA
BKK26640 ([gene|6D6C324675631B5CAB165D6DF72AA45BF3DB6F29|czcO]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26640 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACATTATCACCCCGCCAAT,  downstream forward: _UP4_TAAACGAAGCAGAGCAGTAA
References
15948947,12100555,25383040

6D6C324675631B5CAB165D6DF72AA45BF3DB6F29

Page visits: 1113

Time of last update: 2022-05-20 16:05:04

Author of last update: Jstuelk