yojK

yojK
168

similar to macrolide glycosyltransferase

locus
BSU_19420
Molecular weight
45.44 kDa
pI
4.92
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yojK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1819

This gene is a member of the following regulons

Gene
Coordinates
2,117,051  2,118,268
The protein
Protein family
UDP-glycosyltransferase family (with [protein|02927D2CC9F44B99DB307DDFED2DD52DE2196120|yjiC] and [protein|BD82663B1BF2763D2D2DE710C2896E4155419324|ydhE], according to UniProt)
Structure
[PDB|4M83] (from Streptomyces antibioticus, 28% identity)
[AF|O31853]
Expression and Regulation
Operons
genes
[gene|6D808BC20ADB6CA789288D50CA816D6BEE22CFC3|yojK]
description
[Pubmed|22383849]
Open in new tab

[gene|6D808BC20ADB6CA789288D50CA816D6BEE22CFC3|yojK]

2022-11-28 23:04:12

ghost

19

3752f15bc59cdb7dffa093b55e7a81c117137980

15F607AC90075B7344E704E91E872E7F82E5D052

Biological materials
Mutant
MGNA-B425 (yojK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1424 NBRP B. subtilis, Japan]
BKE19420 ([gene|6D808BC20ADB6CA789288D50CA816D6BEE22CFC3|yojK]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE19420 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCGGCAGCACCCTTCCT,  downstream forward: _UP4_TAGTGTAAAAGCCTGTTCTT
BKK19420 ([gene|6D808BC20ADB6CA789288D50CA816D6BEE22CFC3|yojK]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK19420 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCGGCAGCACCCTTCCT,  downstream forward: _UP4_TAGTGTAAAAGCCTGTTCTT
References
27130432,22383849,31786106,36091437

6D808BC20ADB6CA789288D50CA816D6BEE22CFC3

Page visits: 1332

Time of last update: 2022-11-29 03:33:55

Author of last update: Jstuelk