yxeA

yxeA
168

unknown

locus
BSU_39620
Molecular weight
12.88 kDa
pI
8.1
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yxeA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5294

This gene is a member of the following regulons

Gene
Coordinates
4,068,189  4,068,536
The protein
Structure
[PDB|3NPP]
[AF|P54940]
Expression and Regulation
Operons
genes
[gene|8B4267532B9788AEB5EF39E2695C1FDA494C7055|yxdL]-[gene|4423383A3F6DAFDFA210F4BEEF7D8CBEC674DCEA|yxdM]-[gene|6D9153BA698101C3EE1CD68B76419ECD300740F8|yxeA]
description
[Pubmed|15289557]
regulation
induced by a cationic antimicrobial peptide, LL-37 ([protein|search|YxdJ]) [Pubmed| 21078927]
regulatory mechanism
[protein|F3C5505E311E6DDABAFA87899F28CF6596CDBA63|yxdJ]: activation, [Pubmed|15289557], in [regulon|protein:F3C5505E311E6DDABAFA87899F28CF6596CDBA63|yxdJ regulon]
Open in new tab

[gene|8B4267532B9788AEB5EF39E2695C1FDA494C7055|yxdL]→[gene|6D9153BA698101C3EE1CD68B76419ECD300740F8|yxeA]

2022-11-28 22:02:23

ghost

27

1ab86e0dc85847b3c96c257da5ca800b574323a8

8B1742B0EB6B6B4B987D10A9F8126850382B12E8

Biological materials
Mutant
MGNA-B775 (yxeA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1774 NBRP B. subtilis, Japan]
BKE39620 ([gene|6D9153BA698101C3EE1CD68B76419ECD300740F8|yxeA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE39620 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGCTTTTTTCATCTTTGCAC,  downstream forward: _UP4_TGAATCATAAAAAACGGCAC
BKK39620 ([gene|6D9153BA698101C3EE1CD68B76419ECD300740F8|yxeA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK39620 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGCTTTTTTCATCTTTGCAC,  downstream forward: _UP4_TGAATCATAAAAAACGGCAC
References
15289557,21078927

6D9153BA698101C3EE1CD68B76419ECD300740F8

Page visits: 999

Time of last update: 2022-11-27 00:11:23

Author of last update: Bzhu