ybcI

ybcI
168

component of the membrane potential-generating system [protein|CCDDC414E266D86B9027EA67EA565D87357023B3|MpsA]-[protein|E04C67FB0EA3FFEC8FB68440F4661505C3DFDA29|MpsB]-[protein|6E063903E9E3B770CAACA9DF98DFA540FAE6FD3D|MpsC]

locus
BSU_01880
Molecular weight
13.72 kDa
pI
8.92
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ybcI, mpsB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5609

This gene is a member of the following regulons

Gene
Coordinates
210,572  210,946
The protein
Structure
[AF|O34380]
Expression and Regulation
Operons
genes
[gene|CCDDC414E266D86B9027EA67EA565D87357023B3|ndhF]-[gene|E04C67FB0EA3FFEC8FB68440F4661505C3DFDA29|ybcC]-[gene|5D96DF2F32050BBCEC3811843398FE84DE88F6DF|ybcF]-[gene|EBE0360D89E50EEBB84CC853C6E4B4053DBF8925|ybcH]-[gene|6E063903E9E3B770CAACA9DF98DFA540FAE6FD3D|ybcI]
description
[Pubmed|22383849]
Open in new tab

[gene|CCDDC414E266D86B9027EA67EA565D87357023B3|ndhF]→[gene|6E063903E9E3B770CAACA9DF98DFA540FAE6FD3D|ybcI]

2022-11-23 22:27:08

Jstuelk

37

e140e954b90890d3138431566447fb6e0403ad92

FF8650333154CD6783C7E2C33588F0F5E9F40953

Biological materials
Mutant
BKE01880 ([gene|6E063903E9E3B770CAACA9DF98DFA540FAE6FD3D|ybcI]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE01880 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCTAATACATCTCCTG,  downstream forward: _UP4_TAATCTAAAGAAAATAAATG
BKK01880 ([gene|6E063903E9E3B770CAACA9DF98DFA540FAE6FD3D|ybcI]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK01880 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCTAATACATCTCCTG,  downstream forward: _UP4_TAATCTAAAGAAAATAAATG
Original Publications
25448817

6E063903E9E3B770CAACA9DF98DFA540FAE6FD3D

Page visits: 899

Time of last update: 2022-11-28 13:21:01

Author of last update: Jstuelk