sspI

sspI
168

small acid-soluble spore protein (minor), SASP

locus
BSU_28660
Molecular weight
7.72 kDa
pI
4.49
Protein length
Gene length
function
protection of spore DNA
product
small acid-soluble spore protein (minor), SASP
essential
no
synonyms
sspI, ysfA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5856

This gene is a member of the following regulons

Gene
Coordinates
2,931,692  2,931,907
The protein
Protein family
sspI family (single member, according to UniProt)
Structure
[AF|P94537]
Expression and Regulation
Operons
genes
[gene|6E0B963D2334CEAFC19E4B6E224F7899A41A4B94|sspI]
description
[Pubmed|10806362]
regulation
expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325,10806362]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|16497325,10806362], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|6E0B963D2334CEAFC19E4B6E224F7899A41A4B94|sspI]

2023-01-05 12:19:54

ghost

17

4f14db2d45a9dd8d8c104db78a71067a8f9ce4ee

9297FE756BA318080011EB2CE0EA102CA061772F

additional information
the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
Biological materials
Mutant
MGNA-B025 (ysfA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1024 NBRP B. subtilis, Japan]
BKE28660 ([gene|6E0B963D2334CEAFC19E4B6E224F7899A41A4B94|sspI]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE28660 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTAAAACGCTCCTTTTT,  downstream forward: _UP4_TAAGACATGAAACCGGGTGA
BKK28660 ([gene|6E0B963D2334CEAFC19E4B6E224F7899A41A4B94|sspI]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK28660 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTAAAACGCTCCTTTTT,  downstream forward: _UP4_TAAGACATGAAACCGGGTGA
References
Reviews
35638784
Original Publications
10806362,16497325,30782632

6E0B963D2334CEAFC19E4B6E224F7899A41A4B94

Page visits: 1154

Time of last update: 2023-02-04 21:04:04

Author of last update: Jstuelk