SubtiWiki SubtiWiki
pftA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

pftA
168

pyruvate transporter

locus
BSU_28910
Molecular weight
15.57 kDa
pI
9.82
Protein length
Gene length
function
uptake of pyruvate
product
pyruvate transporter
essential
no
synonyms
pftA, ysbA, lrgA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1380

This gene is a member of the following regulons

Gene
Coordinates
2,955,209  2,955,649
Phenotypes of a mutant
strongly impaired growth with pyruvate as the single carbon source [Pubmed|28974613,27422364]
''[gene|6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462|pftA]-[gene|F6C3B267106E7510FABECF0B13ABF222901689A9|pftB]'' mutant is delayed in pellicle formation [Pubmed|26060272]
a ''[gene|7DA08C189F5524D4874E2F4828264AB2671A5460|ywbH]-[gene|2940E73F0BCAB69992BBD224402C95C2667757AD|ywbG] [gene|E5E431AC5A7D03EEFF6D694CB25EED1570D739A2|yxaK]-[gene|5A43EDB738641C675D4136269F3638F9B609F238|yxaC] [gene|6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462|pftA]-[gene|F6C3B267106E7510FABECF0B13ABF222901689A9|pftB]'' triple mutant is severely delayed in pellicle formation [Pubmed|26060272]
The protein
Catalyzed reaction/ biological activity
uptake of pyruvate [pubmed|28974613]
Protein family
CidA/LrgA family (with [protein|7DA08C189F5524D4874E2F4828264AB2671A5460|ywbH], according to UniProt)
[wiki|Localization]
cell membrane [pubmed|28974613]
Expression and Regulation
Operons
genes
[gene|6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462|pftA]-[gene|F6C3B267106E7510FABECF0B13ABF222901689A9|pftB]
description
[Pubmed|21815947]
regulation
induced by acetate [Pubmed|26060272]
induced by pyruvate ([protein|53BA24E91EEC797C95B8975C487F3C50CBBFA2E3|lytT]) [pubmed|28974613]
subject to carbon catabolite repression ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]) [pubmed|28974613]
regulatory mechanism
[protein|53BA24E91EEC797C95B8975C487F3C50CBBFA2E3|lytT]: activation, [Pubmed|28974613,27422364], in [regulon|protein:53BA24E91EEC797C95B8975C487F3C50CBBFA2E3|lytT regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, ([Pubmed|28974613,27422364], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|65E2F7197D46F5C884CC96018EE4F3EEE94FFA18|kre]: repression, in [regulon|protein:65E2F7197D46F5C884CC96018EE4F3EEE94FFA18|kre regulon]
additional information
the [gene|6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462|pftA]-[gene|F6C3B267106E7510FABECF0B13ABF222901689A9|pftB] operon is strongly upregulated in a ''[wiki|kre]'' mutant [Pubmed|26110430]
the [gene|6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462|pftA]-[gene|F6C3B267106E7510FABECF0B13ABF222901689A9|pftB] operon is strongly upregulated in a ''[wiki|cshA]'' mutant [Pubmed|23175651]
Open in new tab

[gene|6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462|pftA]→[gene|F6C3B267106E7510FABECF0B13ABF222901689A9|pftB]

2022-01-26 22:25:05

Jstuelk

14

ce4916b0164540e2bd6942d8bdd1a80a4d3d3248

0250E8970D3DB5ED35BF13FB7FD8459929EA2708

Biological materials
Mutant
MGNA-B013 (ysbA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1012 NBRP B. subtilis, Japan]
GP1554 (''[gene|6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462|pftA]-[gene|F6C3B267106E7510FABECF0B13ABF222901689A9|pftB]''::''spc''), available in [wiki|Jörg Stülke]'s lab
BKE28910 ([gene|6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462|pftA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28910 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTTCACCTCTTTCT,  downstream forward: _UP4_TAAGGGAAACAGGAGGTTCT
BKK28910 ([gene|6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462|pftA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28910 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTTCACCTCTTTCT,  downstream forward: _UP4_TAAGGGAAACAGGAGGTTCT
References
Reviews
27511628,29208748,29354650
Original Publications
26060272,23175651,21815947,15659658,17452642,26110430,27422364,28974613

6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462

Page visits: 2237

Time of last update: 2022-01-26 13:43:20

Author of last update: Melvin.boenninger