SubtiWiki SubtiWiki
glcR

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

glcR
168

transcriptional repressor ([wiki|DeoR family]) of the [gene|6F5831A480B72D17B7B3F0BF7AF147603B65CA49|glcR]-[gene|AF9523D3AA3C032B70175BCFFED34E9A42ED01AF|phoC] operon

locus
BSU_36300
Molecular weight
28.67 kDa
pI
5.69
Protein length
Gene length
function
unknown
product
transcriptional repressor ([wiki|DeoR family])
essential
no
synonyms
glcR, ywpI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1349

This gene is a member of the following regulons

Gene
Coordinates
3,739,206  3,739,982
The protein
Protein family
[wiki|DeoR family] of transcription factors
[wiki|Domains]
[wiki|HTH deoR-type domain] (aa 3-58) (according to UniProt)
Additional information
Mutant forms of GlcR act as "super-repressors" of'' [gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]'' expression [Pubmed|11491085]
Expression and Regulation
Operons
genes
[gene|6F5831A480B72D17B7B3F0BF7AF147603B65CA49|glcR]-[gene|AF9523D3AA3C032B70175BCFFED34E9A42ED01AF|phoC]
description
[Pubmed|30782637,22383849]
regulation
induced by phosphosugar stress [Pubmed|30782637]
regulatory mechanism
[protein|6F5831A480B72D17B7B3F0BF7AF147603B65CA49|glcR]: repression, [pubmed|30782637], in [regulon|protein:6F5831A480B72D17B7B3F0BF7AF147603B65CA49|glcR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [pubmed|30782637], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|6F5831A480B72D17B7B3F0BF7AF147603B65CA49|glcR]→[gene|AF9523D3AA3C032B70175BCFFED34E9A42ED01AF|phoC]

2021-10-27 14:44:50

Jstuelk

7

8dee298a8a3956d4d162cc157c6929049cd30def

B3796EA6F73FC0EC1853F7DDC479F8A5EED92723

Biological materials
Mutant
MGNA-A530 (ywpI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/530 NBRP B. subtilis, Japan]
BKE36300 ([gene|6F5831A480B72D17B7B3F0BF7AF147603B65CA49|glcR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36300 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGCCCTCATTCCTTTTCT,  downstream forward: _UP4_GATGAAGGAAAGGACTGACA
BKK36300 ([gene|6F5831A480B72D17B7B3F0BF7AF147603B65CA49|glcR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36300 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGCCCTCATTCCTTTTCT,  downstream forward: _UP4_GATGAAGGAAAGGACTGACA
References
11491085,14762004,11948146,22383849,30782637

6F5831A480B72D17B7B3F0BF7AF147603B65CA49

Page visits: 1457

Time of last update: 2022-01-27 08:25:46

Author of last update: Melvin.boenninger