pdxT

pdxT
168

pyridoxal-5-phosphate synthase (glutaminase domain)

locus
BSU_00120
Molecular weight
21.30 kDa
pI
4.98
Protein length
Gene length
function
pyridoxal-5-phosphate biosynthesis
product
pyridoxal-5-phosphate synthase (glutaminase domain)
essential
no
ec
4.3.3.6
synonyms
pdxT, yaaE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0311

This gene is a member of the following regulons

Gene
Coordinates
19,968  20,558
Phenotypes of a mutant
auxotrophic for pyridoxal-5-phosphate at low external ammonium concentration [pubmed|33559288,14762015], this can be suppressed by overexpression of [gene|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS] or the ammonium transporter [protein|796BD46066B1E6147048664FA78679B42FA9D628|nrgA] [pubmed|33559288]
inactivation of [gene|6F96C10759C1C20B3A6B396E3718F0A9281F100A|pdxT] reduces [wiki|sporulation] efficiency to 1.2% that of wild type cells; delayed entry into [wiki|sporulation] [Pubmed|26735940]
poor growth [pubmed|28189581]
non-transformable [pubmed|28189581]
The protein
Catalyzed reaction/ biological activity
Catalyzes the hydrolysis of glutamine to glutamate and ammonia as part of the biosynthesis of pyridoxal 5'-phosphate. The resulting ammonia molecule is channeled to the active site of [protein|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]. (according to UniProt)
aldehydo-D-ribose 5-phosphate + D-glyceraldehyde 3-phosphate + L-glutamine --> H+ + 3 H2O + L-glutamate + phosphate + pyridoxal 5'-phosphate (according to UniProt)
Protein family
Glutaminase PdxT/SNO family (single member, according to UniProt)
Structure
[PDB|2NV2] [protein|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]-[protein|6F96C10759C1C20B3A6B396E3718F0A9281F100A|pdxT] complex [Pubmed|17159152]
[PDB|2NV0] (PdxT) [Pubmed|17159152]
[AF|P37528]
[wiki|Localization]
cytosol (according to UniProt)
Expression and Regulation
Operons
genes
[gene|7C3081BC8D416127A881627EB56C0628359111CF|dacA]-[gene|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]-[gene|6F96C10759C1C20B3A6B396E3718F0A9281F100A|pdxT]-[gene|82B92D2FB8DB88689D3A8B77FAD2F63FCCA04C7E|serS]
description
[Pubmed|22383849]
regulation
the leader mRNA is processed upstream of [gene|7C3081BC8D416127A881627EB56C0628359111CF|dacA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|ymcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|ylbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT] complex [Pubmed|29794222]
Open in new tab

[gene|7C3081BC8D416127A881627EB56C0628359111CF|dacA]→[gene|82B92D2FB8DB88689D3A8B77FAD2F63FCCA04C7E|serS]

2022-11-26 05:34:25

Jstuelk

57

4760e1ef503f91543fe562a8e6f81fd9fdcc9c0c

59F563C38B7236ABF3A723D4A694F254F7E01503

genes
[gene|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]-[gene|6F96C10759C1C20B3A6B396E3718F0A9281F100A|pdxT]
description
[Pubmed|22383849]
regulation
negatively controlled by [wiki|Spo0A] [Pubmed|14651647]
expression is reduced in motile cells as compared to non-motile cells [pubmed|33782055]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: repression, [Pubmed|14651647], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR]: repression, [pubmed|34967415], in [regulon|protein:A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR regulon]
Open in new tab

[gene|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]→[gene|6F96C10759C1C20B3A6B396E3718F0A9281F100A|pdxT]

2022-11-28 15:26:03

Jstuelk

54

63B65B6A7D02DD2F0342EA206857EBB49F7FB19B

F34D4064CCD22AF4406311F14053515BAC721AB2

genes
[gene|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]-[gene|6F96C10759C1C20B3A6B396E3718F0A9281F100A|pdxT]-[gene|82B92D2FB8DB88689D3A8B77FAD2F63FCCA04C7E|serS]
description
[Pubmed|22383849]
Open in new tab

[gene|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]→[gene|82B92D2FB8DB88689D3A8B77FAD2F63FCCA04C7E|serS]

2022-11-28 20:07:24

Jstuelk

54

3a39773e030831d4f4c2ea2177325068c250716a

FEDBE769AE13F9FC0C403044E49C379680B12566

Biological materials
Mutant
BKE00120 ([gene|6F96C10759C1C20B3A6B396E3718F0A9281F100A|pdxT]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00120 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCAGCAGCGCTCCTAT,  downstream forward: _UP4_TAAAACAGTTGAAAGCTGTG
BKK00120 ([gene|6F96C10759C1C20B3A6B396E3718F0A9281F100A|pdxT]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00120 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCAGCAGCGCTCCTAT,  downstream forward: _UP4_TAAAACAGTTGAAAGCTGTG
BV604 (([gene|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]-[gene|6F96C10759C1C20B3A6B396E3718F0A9281F100A|pdxT])::tet), available in [wiki|Fabian Commichau]'s lab,  [Pubmed|24972371]
BP1100 (([gene|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]-[gene|6F96C10759C1C20B3A6B396E3718F0A9281F100A|pdxT])::tet) trp+), available in [wiki|Jörg Stülke]'s and [wiki|Fabian Commichau]'s labs
BP1105 (([gene|6F96C10759C1C20B3A6B396E3718F0A9281F100A|pdxT])::cat) trp+), available in [wiki|Jörg Stülke]'s and [wiki|Fabian Commichau]'s labs
References
Reviews
33665688
Original Publications
15911615,14762015,14651647,16030023,19152323,17159152,23832367,25473090,25568319,26490441,26735940,16233205,14585832,28189581,33559288

6F96C10759C1C20B3A6B396E3718F0A9281F100A

Page visits: 2214

Time of last update: 2022-11-28 18:20:48

Author of last update: Jstuelk