yofA

yofA
168

transcriptional activator of [gene|8AB7D225DBEE6BD695A4A8A2384D2C029B571C57|ftsW] at the onset of stationary phase

locus
BSU_18420
Molecular weight
31.90 kDa
pI
6.16
Protein length
Gene length
function
control of [gene|8AB7D225DBEE6BD695A4A8A2384D2C029B571C57|ftsW] expression
product
transcriptional activator ([wiki|LysR family])
essential
no
synonyms
yofA, ftsR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0583

This gene is a member of the following regulons

Gene
Coordinates
2,006,541  2,007,398
The protein
Protein family
[wiki|LysR family] (according to UniProt)
[wiki|Domains]
[wiki|HTH lysR-type domain] (aa 1-58) (according to UniProt)
Structure
[PDB|4X6G] (from Pseudomonas aeruginosa, 25% identity) [pubmed|25931525]
[AF|O34685]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|6FDA046DCBBAE4588C4BC7163A04B9E6AEDBAC55|yofA]
description
[Pubmed|22383849]
regulation
maximally expressed at the onset of stationary phase [Pubmed|17526699]
Open in new tab

[gene|6FDA046DCBBAE4588C4BC7163A04B9E6AEDBAC55|yofA]

2022-11-21 23:57:34

ghost

18

5f5f2d4b247c472df38b194a6682ba16a16c386a

BD50D5662F4F976A4E237B9C4FDD8F2DEB214F9E

Biological materials
Mutant
MGNA-B090 (yofA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1089 NBRP B. subtilis, Japan]
BKE18420 ([gene|6FDA046DCBBAE4588C4BC7163A04B9E6AEDBAC55|yofA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE18420 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGCGCTCTCACCTGCTTG,  downstream forward: _UP4_TGAAGATAGACGTGCATTAG
BKK18420 ([gene|6FDA046DCBBAE4588C4BC7163A04B9E6AEDBAC55|yofA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK18420 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGCGCTCTCACCTGCTTG,  downstream forward: _UP4_TGAAGATAGACGTGCATTAG
References
17526699,22383849,25931525

6FDA046DCBBAE4588C4BC7163A04B9E6AEDBAC55

Page visits: 1773

Time of last update: 2022-11-20 10:54:51

Author of last update: Melvin.boenninger