SubtiWiki SubtiWiki

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!


thymidylate synthase A

Molecular weight
32.65 kDa
Protein length
Gene length
biosynthesis of thymidine nucleotides
thymidylate synthase A

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0207

This gene is a member of the following regulons

1,902,219  1,903,058
The protein
Catalyzed reaction/ biological activity
(6R)-5,10-methylene-5,6,7,8-tetrahydrofolate + dUMP --> 7,8-dihydrofolate + dTMP (according to UniProt)
Protein family
thymidylate synthase family (with [protein|9F9643D51E9ABA537892B19312491697CECDDCCF|thyB], according to UniProt)
[PDB|1B02] [pubmed|10091656]
Paralogous protein(s)
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Open in new tab


2021-10-04 22:45:54





Biological materials
BKE17680 ([gene|6FE1D3C4D4DF86DE2D3D9A143A1DCFE120F13F5F|thyA]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACTATTCATATCCTTC,  downstream forward: _UP4_TAATGCTGCCTTTTTATTGT
BKK17680 ([gene|6FE1D3C4D4DF86DE2D3D9A143A1DCFE120F13F5F|thyA]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACTATTCATATCCTTC,  downstream forward: _UP4_TAATGCTGCCTTTTTATTGT
Original Publications


Page visits: 2493

Time of last update: 2022-01-17 01:59:33

Author of last update: Melvin.boenninger