thyA
Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.

thyA
168

thymidylate synthase A

locus
BSU_17680
Molecular weight
32.65 kDa
pI
5.5
Protein length
Gene length
function
biosynthesis of thymidine nucleotides
product
thymidylate synthase A
essential
no
ec
2.1.1.45
synonyms
thyA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0207

This gene is a member of the following regulons

Gene
Coordinates
1,902,219  1,903,058
The protein
Catalyzed reaction/ biological activity
(6R)-5,10-methylene-5,6,7,8-tetrahydrofolate + dUMP --> 7,8-dihydrofolate + dTMP (according to UniProt)
Protein family
thymidylate synthase family (with [protein|9F9643D51E9ABA537892B19312491697CECDDCCF|thyB], according to UniProt)
Structure
[PDB|1B02] [pubmed|10091656]
[AF|P0CI79]
Paralogous protein(s)
[protein|9F9643D51E9ABA537892B19312491697CECDDCCF|thyB]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|6FE1D3C4D4DF86DE2D3D9A143A1DCFE120F13F5F|thyA]
description
[Pubmed|22383849]
Open in new tab

[gene|6FE1D3C4D4DF86DE2D3D9A143A1DCFE120F13F5F|thyA]

2022-06-26 07:29:08

Jstuelk

7

5dd9af6ad5f075a1f8953c415545555e99ea63b8

EB8AD199031FF318132352B1C37D7C3668405444

Biological materials
Mutant
BKE17680 ([gene|6FE1D3C4D4DF86DE2D3D9A143A1DCFE120F13F5F|thyA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACTATTCATATCCTTC,  downstream forward: _UP4_TAATGCTGCCTTTTTATTGT
BKK17680 ([gene|6FE1D3C4D4DF86DE2D3D9A143A1DCFE120F13F5F|thyA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACTATTCATATCCTTC,  downstream forward: _UP4_TAATGCTGCCTTTTTATTGT
References
Reviews
7574499
Original Publications
418407,11267663,28700593,10091656,7704257,9648749,111614,29150519

6FE1D3C4D4DF86DE2D3D9A143A1DCFE120F13F5F

Page visits: 2631

Time of last update: 2022-08-05 11:54:52

Author of last update: Melvin.boenninger