hemB

hemB
168

porphobilinogen synthase

locus
BSU_28130
Molecular weight
36.05 kDa
pI
4.98
Protein length
Gene length
function
heme biosynthesis
product
porphobilinogen synthase
essential
no
ec
4.2.1.24
synonyms
hemB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0113

This gene is a member of the following regulons

Gene
Coordinates
2,874,202  2,875,176
The protein
Catalyzed reaction/ biological activity
2 5-aminolevulinate --> porphobilinogen + 2 H2O (according to UniProt)
Protein family
ALAD family (single member, according to UniProt)
[wiki|Cofactors]
zinc
Structure
[PDB|1W5Q] (from ''Pseudomonas aeruginosa'', 48% identity) [Pubmed|15644204]
[AF|P30950]
Modification
phosphorylated on Arg-217 [Pubmed|22517742]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|B1413EB525000744BE8E429E760220A13BC4530D|hemA]-[gene|88616BA1E853E11BE0CB18F06287CA4C68143148|hemX]-[gene|D266E22E07B849E2AEB0EF232C49A2FE1EA4E02B|hemC]-[gene|33459D4389F85D60311FCE770BBA0ED9802BA342|hemD]-[gene|70263A55987F110209367CF45AD65A584AD3077D|hemB]-[gene|A54B2C86638D474F5F892003B42C535B5B39A42E|hemL]
description
[Pubmed|1672867]
regulation
induced by hydrogen peroxide ([protein|search|PerR]) [Pubmed|11532148]
regulatory mechanism
[protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|perR]: repression, [Pubmed|11532148], in [regulon|protein:00BCAAE16576DC5426A652580C69A570FC7A1C2C|perR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1672867], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|B1413EB525000744BE8E429E760220A13BC4530D|hemA]→[gene|A54B2C86638D474F5F892003B42C535B5B39A42E|hemL]

2022-06-23 23:22:23

ghost

23

64840dd729762069005c4bd541ed0ddec6e74ace

168BC8B91CBFE3EA050DA8A9187C8C67D6BBE4F9

Biological materials
Mutant
BKE28130 ([gene|70263A55987F110209367CF45AD65A584AD3077D|hemB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28130 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GCGGTGTCTATTAAATGATT,  downstream forward: _UP4_TAATTTTATTCAGTTGACAG
BKK28130 ([gene|70263A55987F110209367CF45AD65A584AD3077D|hemB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28130 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GCGGTGTCTATTAAATGATT,  downstream forward: _UP4_TAATTTTATTCAGTTGACAG
References
Reviews
28123057
Original Publications
10217486,11532148,1672867,4214010,804803,12926268,20823524,22517742,15644204

70263A55987F110209367CF45AD65A584AD3077D

Page visits: 1643

Time of last update: 2022-06-25 09:38:47

Author of last update: Melvin.boenninger