yckB

yckB
168

similar to amino acid [wiki|ABC transporter] (binding protein)

locus
BSU_03380
Molecular weight
31.57 kDa
pI
8.49
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yckB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0834

This gene is a member of the following regulons

Gene
Coordinates
367,995  368,858
The protein
Protein family
[wiki|bacterial solute-binding protein 3 family] (according to UniProt)
Structure
[PDB|2IEE]
[AF|P42400]
Paralogous protein(s)
[protein|2056F8EEDF9D3027CFD808E8D0C5DF544DBDD3F3|tcyA]
[wiki|Localization]
associated to the membrane (via [protein|1872614A6F7DBF7231348AC3DAE4ED3295ACEB41|yckA]) [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|7050A2CC4BA2183C3CD22A246846CBCE43D73ABC|yckB]-[gene|1872614A6F7DBF7231348AC3DAE4ED3295ACEB41|yckA]
description
[Pubmed|22383849]
Open in new tab

[gene|7050A2CC4BA2183C3CD22A246846CBCE43D73ABC|yckB]→[gene|1872614A6F7DBF7231348AC3DAE4ED3295ACEB41|yckA]

2022-11-21 20:13:32

Jstuelk

32

cd5a57519adc46d46da39741069f94c69b925750

C74A617AE5313DE93EED08FE6C32E099016B6B6E

Biological materials
Mutant
MGNA-C053 (yckB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2051 NBRP B. subtilis, Japan]
CS208 (''[gene|7050A2CC4BA2183C3CD22A246846CBCE43D73ABC|yckB]''::''aphA3'', available in [wiki|Colin Harwood]'s and [wiki|Jörg Stülke]'s labs) [Pubmed|27197833]
BKE03380 ([gene|7050A2CC4BA2183C3CD22A246846CBCE43D73ABC|yckB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACCTATAGTTCCCCCAATC,  downstream forward: _UP4_GACGTTGATTTGTAATCGGA
BKK03380 ([gene|7050A2CC4BA2183C3CD22A246846CBCE43D73ABC|yckB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACCTATAGTTCCCCCAATC,  downstream forward: _UP4_GACGTTGATTTGTAATCGGA
References
10092453,23038252,27197833

7050A2CC4BA2183C3CD22A246846CBCE43D73ABC

Page visits: 1282

Time of last update: 2022-12-01 13:43:35

Author of last update: Melvin.boenninger