yclJ

yclJ
168

two-component response regulator ([wiki|OmpR family]), active under anaerobic conditions

locus
BSU_03750
Molecular weight
26.36 kDa
pI
4.58
Protein length
Gene length
function
unknown
product
two-component response regulator ([wiki|OmpR family])
essential
no
synonyms
yclJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0745

This gene is a member of the following regulons

Gene
Coordinates
426,577  427,260
The protein
Protein family
[wiki|OmpR family] of two-component response regulators
[wiki|Domains]
[wiki|Response regulatory domain] (aa 2-115) (according to UniProt)
Structure
[PDB|2OQR] (RegX3 from Mycobacterium tuberculosis, 42% identity) [pubmed|17942407]
[AF|P94413]
Modification
phosphorylated by [protein|52BB660B0CAB36C74F1D47963235846B45AF78AB|yclK] on an Asp residue
Effectors of protein activity
phosphorylation likely affects DNA-binding activity
Paralogous protein(s)
[protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|walR], [protein|6A37531896205A9B894C81AB0563C216C0B52CD7|ykoG], [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|706983E6942E883D3A9D45693E7B4015AEABE60B|yclJ]-[gene|52BB660B0CAB36C74F1D47963235846B45AF78AB|yclK]
description
[Pubmed|15375128]
regulation
expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|15375128]
regulatory mechanism
[protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]: activation, [Pubmed|15375128], in [regulon|protein:1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD regulon]
Open in new tab

[gene|706983E6942E883D3A9D45693E7B4015AEABE60B|yclJ]→[gene|52BB660B0CAB36C74F1D47963235846B45AF78AB|yclK]

2022-11-30 13:13:59

ghost

29

c8ce174a850d100d730c47471cd54e3718b10202

35D763A96FACAEA24FD2F2D86E1687EA9C120E8E

Biological materials
Mutant
MGNA-C007 (yclJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2005 NBRP B. subtilis, Japan]
BKE03750 ([gene|706983E6942E883D3A9D45693E7B4015AEABE60B|yclJ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03750 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTATATCCTCCGGTTGTT,  downstream forward: _UP4_ACTGTGTGGGGAGTAGGGTA
BKK03750 ([gene|706983E6942E883D3A9D45693E7B4015AEABE60B|yclJ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03750 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTATATCCTCCGGTTGTT,  downstream forward: _UP4_ACTGTGTGGGGAGTAGGGTA
References
10094672,20512483,15375128,23504016,17942407

706983E6942E883D3A9D45693E7B4015AEABE60B

Page visits: 2215

Time of last update: 2022-12-01 09:39:33

Author of last update: Melvin.boenninger