yddS

yddS
168

similar to metabolite transport protein

locus
BSU_05090
Molecular weight
44.68 kDa
pI
9.8
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yddS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2814

This gene is a member of the following regulons

Gene
Coordinates
554,669  555,979
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
Structure
[AF|P96656]
[wiki|Localization]
cell membrane (according to UniProt)
Biological materials
Mutant
MGNA-C127 (yddS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2125 NBRP B. subtilis, Japan]
BKE05090 ([gene|707E2D9F7EA6E4A75FB0168BF7B14F20691F99DF|yddS]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE05090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAATTCTACCTCCTAAC,  downstream forward: _UP4_TAAGCTTATATAACTGTCTT
BKK05090 ([gene|707E2D9F7EA6E4A75FB0168BF7B14F20691F99DF|yddS]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK05090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAATTCTACCTCCTAAC,  downstream forward: _UP4_TAAGCTTATATAACTGTCTT

707E2D9F7EA6E4A75FB0168BF7B14F20691F99DF

Page visits: 1194

Time of last update: 2022-11-25 10:00:03

Author of last update: Melvin.boenninger