yvrHb

yvrHb
168

two-component response regulator ([wiki|OmpR family])

locus
BSU_33221
Molecular weight
27.00 kDa
pI
5.235
Protein length
Gene length
function
regulation cell surface maintenance
product
two-component response regulator ([wiki|OmpR family])
essential
no
synonyms
yvrHb, yvrH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0745

This gene is a member of the following regulons

Gene
Coordinates
3,408,353  3,409,066
Phenotypes of a mutant
unusual autolysis and higher susceptibility to cell envelope antibiotics (bacitracin, aztreonam, cefepime, fosfomycin)  [Pubmed|16306698]
The protein
Catalyzed reaction/ biological activity
transcription activator  [Pubmed|16306698]
Protein family
[wiki|OmpR family] of two-component response regulators
[wiki|Domains]
[wiki|Response regulatory domain] (aa 5-119) (according to UniProt)
Structure
[PDB|2OQR] (from Mycobacterium tuberculosis, 37% identity) [pubmed|17942407]
[AF|P94504]
Modification
phosphorylation (Asp) by [protein|96E4470EF4B558F4EC318FEBF58B779BA50DB7E2|yvrG]  [Pubmed|16306698]
Effectors of protein activity
phosphorylation likely affects DNA-binding activity
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb]-[gene|96E4470EF4B558F4EC318FEBF58B779BA50DB7E2|yvrG]-[gene|0F65F634368E935585FC015BA64085F3A2244F9B|yvrE]
description
[Pubmed|22383849]
Open in new tab

[gene|7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb]→[gene|0F65F634368E935585FC015BA64085F3A2244F9B|yvrE]

2022-11-19 10:09:16

Jstuelk

36

7b1ca7d9926202cb67b2f5ca02dc23abca36fbb6

F9AB94FC785A9E813163AC0107521543FD5405BF

Biological materials
Mutant
MGNA-B050 (yvrH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1049 NBRP B. subtilis, Japan]
BKE33221 ([gene|7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE33221 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTTTATGTTCCTTTCTG,  downstream forward: _UP4_CCAAATCCTGAAGGCAAGCG
BKK33221 ([gene|7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK33221 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTTTATGTTCCTTTCTG,  downstream forward: _UP4_CCAAATCCTGAAGGCAAGCG
References
10094672,18820022,16306698,17942407

7098319D8E88FDC2A629A3F4A21507FD7A649385

Page visits: 2852

Time of last update: 2022-11-29 15:41:29

Author of last update: Melvin.boenninger