yteA

yteA
168

sporulation protein

locus
BSU_30840
Molecular weight
27.56 kDa
pI
4.03
Protein length
Gene length
function
unknown
product
sporulation protein
essential
no
ec
null
synonyms
yteA, yzwB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1734

This gene is a member of the following regulons

Gene
Coordinates
3,154,007  3,154,726
The protein
Structure
[AF|P42408]
Paralogous protein(s)
[protein|8AB50581EBB3C27BB9A96EA3382F8C90CE5B6EC5|ylyA], [protein|633F6F54AFA144D4F65EA36B8D5670D3FC25EDA6|yocK]
Expression and Regulation
Operons
genes
[gene|70A5A147B908001878161D45AAEB08132AD0DB8C|yteA]
description
[Pubmed|9387221]
regulation
expressed late during [wiki|sporulation] in the forespore ([protein|search|SigG], [wiki|SpoVT]) [Pubmed|23123912,16497325]
regulatory mechanism
[protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]: activation, [Pubmed|23123912], in [regulon|protein:01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT regulon]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|70A5A147B908001878161D45AAEB08132AD0DB8C|yteA]

2023-01-31 13:15:33

ghost

14

db8a1f574811b8fccb5de0ac299dc3a8cd258346

6EADBA4B6372CE896464296F08D6035ECAE5283D

Biological materials
Mutant
MGNA-A282 (yteA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/282 NBRP B. subtilis, Japan]
BKE30840 ([gene|70A5A147B908001878161D45AAEB08132AD0DB8C|yteA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE30840 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGTGATCGCCTCGTTTC,  downstream forward: _UP4_CTCCACGCTGATTGAACCCC
BKK30840 ([gene|70A5A147B908001878161D45AAEB08132AD0DB8C|yteA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK30840 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGTGATCGCCTCGTTTC,  downstream forward: _UP4_CTCCACGCTGATTGAACCCC
References
16497325,9387221,23123912

70A5A147B908001878161D45AAEB08132AD0DB8C

Page visits: 1299

Time of last update: 2023-02-05 22:59:24

Author of last update: Bzhu