opuBB

opuBB
168

choline and arsenocholine [wiki|ABC transporter] (membrane protein)

locus
BSU_33720
Molecular weight
23.02 kDa
pI
9.74
Protein length
Gene length
function
compatible solute transport
product
choline and arsenocholine [wiki|ABC transporter] (membrane protein)
essential
no
synonyms
opuBB, proW

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1174

This gene is a member of the following regulons

Gene
Coordinates
3,461,435  3,462,088
The protein
Catalyzed reaction/ biological activity
uptake of choline and arsenocholine [pubmed|29159878]
Protein family
[wiki|Binding-protein-dependent transport system permease family] (according to UniProt)
[wiki|CysTW subfamily] (according to UniProt)
[wiki|Domains]
[wiki|ABC transmembrane type-1 domain] (aa 19-198) (according to UniProt)
Structure
[AF|Q45461]
Paralogous protein(s)
[protein|83C45215AC86FACB08CF36EB5F9E6B076D7D0F0F|opuCB]
[wiki|Localization]
cell membrane [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|3F502A4DCB1DAD7C3F968465B13C35213240515B|opuBA]-[gene|70B45E7428DB1F6AEF7D2FE3062CC86BE96674FC|opuBB]-[gene|C48798FE13B1521236F5BC5786B9A02D7BC9A336|opuBC]-[gene|1532EC3D741C5AB3D0B642741218FAE00AD460FA|opuBD]
description
[Pubmed|10216873]
regulation
induced by choline ([protein|search|GbsR]) [Pubmed|22408163]
regulatory mechanism
[protein|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|gbsR]: repression, (transcriptional roadblock) [Pubmed|32849357,22408163], in [regulon|protein:5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|gbsR regulon]
[protein|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|opcR]: repression, (sterical interference with RNA polymerase access) [Pubmed|32849357,23960087], in [regulon|protein:9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|opcR regulon]
[protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]: activation, [Pubmed|23646920], in [regulon|protein:6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10216873], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
An antisense RNA is predicted for'[protein|search|opuBD]' [PubMed|20525796]
Open in new tab

[gene|3F502A4DCB1DAD7C3F968465B13C35213240515B|opuBA]→[gene|1532EC3D741C5AB3D0B642741218FAE00AD460FA|opuBD]

2022-11-25 06:18:18

ghost

24

f5d474616565c5e32550f1c34aef09f972669a8e

1F7D81939583251B3B9B9F3D0D915C77CF89D428

Biological materials
Mutant
BKE33720 ([gene|70B45E7428DB1F6AEF7D2FE3062CC86BE96674FC|opuBB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE33720 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACTTATCGCCCCTCCC,  downstream forward: _UP4_GAATTGTCATAAGGAGGCGG
BKK33720 ([gene|70B45E7428DB1F6AEF7D2FE3062CC86BE96674FC|opuBB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK33720 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACTTATCGCCCCTCCC,  downstream forward: _UP4_GAATTGTCATAAGGAGGCGG
References
Reviews
27935846
Original Publications
10092453,9925583,10216873,23646920,21296969,23960087,22408163,29159878,32373088

70B45E7428DB1F6AEF7D2FE3062CC86BE96674FC

Page visits: 1524

Time of last update: 2022-11-30 06:44:59

Author of last update: Jstuelk