ydaK

ydaK
168

general stress protein, may act as c-di-GMP receptor, required for extracellular polysaccharide synthesis by [protein|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]-[protein|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]-[protein|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]

locus
BSU_04280
Molecular weight
32.53 kDa
pI
6.7
Protein length
Gene length
function
unknown
product
putative c-di-GMP receptor protein, general stress protein
essential
no
synonyms
ydaK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2199

This gene is a member of the following regulons

Gene
Coordinates
480,013  480,864
The protein
[wiki|Domains]
four transmembrane helices at the N-terminus, they are essential for activation of EPS formation by [protein|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL], [protein|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM], and [protein|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN] [pubmed|28536559]
contains a C-terminal degenerated [wiki|GGDEF domain] (aa 162-283) [Pubmed|23893111]
[wiki|Cofactors]
binds c-di-GPM at high concentration (K(D) for c-di-GMP: 1.1 myM) [Pubmed|23893111]
Structure
[AF|P96585]
[wiki|Localization]
cell membrane, forms clusters at the cell poles and septa (with [protein|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM] and [protein|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]) [Pubmed|27897378]
Expression and Regulation
Operons
genes
[gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]-[gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]-[gene|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]-[gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]-[gene|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]
description
[Pubmed|22383849]
regulation
expressed during stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]) [Pubmed|22383849]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|22383849], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]→[gene|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]

2022-12-01 23:42:44

Jstuelk

27

b605f66f599d67e539c67d5e096567c2b2e56ae4

80FCF67C03206CFA39A835FC21447D9DDEAF08EF

Biological materials
Mutant
MGNA-C074 (ydaK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2072 NBRP B. subtilis, Japan]
GP1592 (kan) available in [wiki|Jörg Stülke]'s lab
JH642 and its derivatives: natural deletion of the 18 kb [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH] region encompassing the genes [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|7D5327BD1DD5FD5F90B2C849589923AA3D8B20EF|topB]-[gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]-[gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]-[gene|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]-[gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]-[gene|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]-[gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]-[gene|6085BDAD40F719555EA4EEA7BBAD74103BD03D0F|mutT]-[gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]-[gene|87834D5C47064BEFF26F086A8202C311F28F9D38|ydzK]-[gene|search|mntH ][pubmed|18670626]
BKE04280 ([gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04280 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAAATAAGCAAATAATTTTT,  downstream forward: _UP4_ATGAATGAACTATAAAGGAA
BKK04280 ([gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04280 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAAATAAGCAAATAATTTTT,  downstream forward: _UP4_ATGAATGAACTATAAAGGAA
References
Reviews
28296273
Original Publications
22383849,22821967,23893111,27897378,28536559,32156823

70ED3CE683F3A3F785480F40986CABE7729C17C7

Page visits: 1943

Time of last update: 2022-12-05 18:47:59

Author of last update: Jstuelk