penP

penP
168

beta-lactamase

locus
BSU_18800
Molecular weight
33.29 kDa
pI
9.21
Protein length
Gene length
function
resistance to beta-lactam antibiotics
product
beta-lactamase
essential
no
ec
3.5.2.6
synonyms
penP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2367

This gene is a member of the following regulons

Gene
Coordinates
2,048,533  2,049,453
The protein
Catalyzed reaction/ biological activity
β-lactam + H2O --> substituted β-amino acid (according to UniProt)
Protein family
[wiki|beta-lactamase family] (according to UniProt)
class-A beta-lactamase family (single member, according to UniProt)
Structure
[PDB|6NI1]
[AF|P39824]
[wiki|Localization]
extracellular (signal peptide) [Pubmed|18957862]
Expression and Regulation
Operons
genes
[gene|713BAB7190E1F86C55103049B29072F00E0DFFB3|penP]
description
[Pubmed|22383849]
Open in new tab

[gene|713BAB7190E1F86C55103049B29072F00E0DFFB3|penP]

2022-11-25 10:03:41

Jstuelk

24

60af3192ad9a596670c5dcfe32cd3211558621a6

C31C291573043B0EFEE1A1E30A713F15E926C22D

Biological materials
Mutant
BKE18800 ([gene|713BAB7190E1F86C55103049B29072F00E0DFFB3|penP]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE18800 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCAGGCCTCCTCATTCAA,  downstream forward: _UP4_TAATATGTTTAGCCTTTTGC
BKK18800 ([gene|713BAB7190E1F86C55103049B29072F00E0DFFB3|penP]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK18800 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCAGGCCTCCTCATTCAA,  downstream forward: _UP4_TAATATGTTTAGCCTTTTGC
References
18957862,30637927

713BAB7190E1F86C55103049B29072F00E0DFFB3

Page visits: 2565

Time of last update: 2022-11-29 05:38:06

Author of last update: Melvin.boenninger