sspK

sspK
168

small acid-soluble spore protein (minor) SASP

locus
BSU_08550
Molecular weight
5.72 kDa
pI
10.18
Protein length
Gene length
function
protection of spore DNA
product
small acid-soluble spore protein (minor) SASP
essential
no
synonyms
sspK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5857

This gene is a member of the following regulons

Gene
Coordinates
928,112  928,264
The protein
Protein family
sspK family (single member, according to UniProt)
Structure
[AF|Q7WY75]
[wiki|Localization]
spore core (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|720E08387CA2B2ED6F1CC35E1F8756EFEFC43385|sspK]
description
[Pubmed|10806362]
regulation
expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,10806362], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|720E08387CA2B2ED6F1CC35E1F8756EFEFC43385|sspK]

2022-11-28 23:53:43

ghost

11

7a4ebab73034ff5947b4b2fd3fa2fb34dd7686e0

8E771EC42625ADE674AA72B23E957E634A7A632A

additional information
the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
Biological materials
Mutant
BKE08550 ([gene|720E08387CA2B2ED6F1CC35E1F8756EFEFC43385|sspK]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE08550 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCATATCCCCCTAGGT,  downstream forward: _UP4_TAAAGAAGAACAGCTGCATA
BKK08550 ([gene|720E08387CA2B2ED6F1CC35E1F8756EFEFC43385|sspK]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK08550 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCATATCCCCCTAGGT,  downstream forward: _UP4_TAAAGAAGAACAGCTGCATA
References
10806362,30782632

720E08387CA2B2ED6F1CC35E1F8756EFEFC43385

Page visits: 1066

Time of last update: 2023-02-02 21:37:58

Author of last update: Melvin.boenninger