copA

copA
168

copper-transporting ATPase, resistance to copper

locus
BSU_33500
Molecular weight
85.83 kDa
pI
5.48
Protein length
Gene length
function
copper export, detoxification
product
copper transporting ATPase
essential
no
synonyms
copA, yvgX

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2608

This gene is a member of the following regulons

Gene
Coordinates
3,441,121 → 3,443,529
The protein
Catalyzed reaction/ biological activity
ATP + Cu+ + H2O --> ADP + Cu+ + H+ + phosphate (according to UniProt)
Protein family
[wiki|cation transport ATPase (P-type) (TC 3.A.3) family] (according to UniProt)
[wiki|Domains]
two N-terminal soluble domains, CopAa and CopAb, connected by a short linker [pubmed|29146226]
2 HMA domains (aa 6-72, aa 74-140) (according to UniProt)
Structure
[PDB|4BBJ] (the protein from ''Legionella pneumophila'', 45% identity, 79% similarity) [Pubmed|24317491]
[PDB|2RML] ( N-terminal soluble domain) [pubmed|18215122]
[AF|O32220]
Paralogous protein(s)
[protein|017A57F27DD8E515242FB658A61E74C1D58273CC|pfeT], [protein|5BC6B02770E74FF6D453742832574A87BB2369B8|cadA]
[wiki|Localization]
cell membrane (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|6977F18870004AD236539D9409255815E6BE9241|csoR]-[gene|18506FB74F6BB9278F22EB7DCDA3CF72575CC32A|copZ]-[gene|727024F7B1AC19676ED4B516CF46A47B1328310B|copA]
description
[Pubmed|22383849]
Open in new tab

[gene|6977F18870004AD236539D9409255815E6BE9241|csoR]→[gene|727024F7B1AC19676ED4B516CF46A47B1328310B|copA]

2022-06-21 05:51:32

Jstuelk

15

eb86b49e4fa20367c75145f1a228f37db4b5da04

AAFF284B2BD1673523D4C48EA1D3231D7A156AFC

genes
[gene|18506FB74F6BB9278F22EB7DCDA3CF72575CC32A|copZ]-[gene|727024F7B1AC19676ED4B516CF46A47B1328310B|copA]
description
[Pubmed|12779235]
regulation
induced by copper ([protein|search|CsoR]) [Pubmed|18048925,12779235]
regulatory mechanism
[protein|6977F18870004AD236539D9409255815E6BE9241|csoR]: repression, [Pubmed|18048925], in [regulon|protein:6977F18870004AD236539D9409255815E6BE9241|csoR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12779235], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|18506FB74F6BB9278F22EB7DCDA3CF72575CC32A|copZ]→[gene|727024F7B1AC19676ED4B516CF46A47B1328310B|copA]

2022-06-21 12:53:13

ghost

21

82e064a450e42e8934b8717c092adbe5ec47123b

C1EEB785789E5FED12C2A62EF4EB3404C7EFF35B

Biological materials
Mutant
MGNA-A490 (yvgX::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/490 NBRP B. subtilis, Japan]
BKE33500 (Δ[gene|727024F7B1AC19676ED4B516CF46A47B1328310B|copA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33500 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACATACTCACTCCTTTAT,  downstream forward: _UP4_TGAAAAACCGGCTATATGCC
BKK33500 (Δ[gene|727024F7B1AC19676ED4B516CF46A47B1328310B|copA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33500 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACATACTCACTCCTTTAT,  downstream forward: _UP4_TGAAAAACCGGCTATATGCC
labs
[wiki|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
References
Reviews
19824702,23046649
Original Publications
19751213,11922674,12590580,14663075,12779235,12644235,18048925,14514665,14711369,19378562,15212800,20233928,24317491,22531974,22077885,28078344,29146226,30342352,18215122

727024F7B1AC19676ED4B516CF46A47B1328310B

Page visits: 1793

Time of last update: 2022-06-25 03:55:19

Author of last update: Melvin.boenninger