mneS

mneS
168

secondary manganese (II) efflux pump

locus
BSU_06320
Molecular weight
31.63 kDa
pI
5.63
Protein length
Gene length
function
Mn(II) export
product
manganese (II) efflux pump
essential
no
synonyms
mneS, undefined, ydxT, yeaB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0053

This gene is a member of the following regulons

Gene
Coordinates
686,962  687,834
Phenotypes of a mutant
a [gene|28C7CFE5701F6920652BE1973DC7A15D7C088E35|mneP] [gene|72BF9B934CB5800E156263FF377DED0AD2E920A9|mneS] double mutant is extremely senitive to Mn2+ intoxication, this results in generation of reactive radicals by poisoned cytochrome aa3 oxidase [protein|48A9E1E39838BFFCF12CADF0A8D8E6FFDCA6F175|qoxA]-[protein|CBF2DCFFD8195304F942ECBA8596444F0AC47CC6|qoxB]-[protein|CD4520EF427AEFDCF028AE063BC373FA6DCE379E|qoxC]-[protein|03335DC50CED7B38E2380640AE108ADA09A2CBDF|qoxD] and can be suppressed by inactivation of [protein|48A9E1E39838BFFCF12CADF0A8D8E6FFDCA6F175|qoxA]-[protein|CBF2DCFFD8195304F942ECBA8596444F0AC47CC6|qoxB]-[protein|CD4520EF427AEFDCF028AE063BC373FA6DCE379E|qoxC]-[protein|03335DC50CED7B38E2380640AE108ADA09A2CBDF|qoxD] (any gene) or of [gene|997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR] to activate the electrophile stress response [pubmed|34097790,31685536]
The protein
Catalyzed reaction/ biological activity
efflux of Mn(II) [Pubmed|27748968]
Protein family
[wiki|Cation diffusion facilitator (CDF) transporter (TC 2.A.4) family] [Pubmed|27748968]
Structure
[PDB|5VRF] (from Shewanella oneidensis, 28% identity) [pubmed|29507252]
[AF|P46348]
Paralogous protein(s)
[protein|D52111E81E9233DABAEFCAF6217145CF6A7F3961|ydbO], [protein|28C7CFE5701F6920652BE1973DC7A15D7C088E35|mneP]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|72BF9B934CB5800E156263FF377DED0AD2E920A9|mneS]
description
[pubmed|22383849]
regulatory mechanism
[protein|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR]: transcription activation, [Pubmed|27748968], in [regulon|protein:FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|27748968], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|72BF9B934CB5800E156263FF377DED0AD2E920A9|mneS]

2022-11-22 14:48:20

Bzhu

13

a6a6b660326f61d7f9ee99bd00edc6c82f2fcacb

2B854B46BCDA1050F8B8549DC32BFA53E7D54E43

Biological materials
Mutant
MGNA-A914 (yeaB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/914 NBRP B. subtilis, Japan]
BKE06320 ([gene|72BF9B934CB5800E156263FF377DED0AD2E920A9|mneS]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE06320 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACAAAACCTCCTCTCGC,  downstream forward: _UP4_TAATGGAGCTTCCTGTCACA
BKK06320 ([gene|72BF9B934CB5800E156263FF377DED0AD2E920A9|mneS]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK06320 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACAAAACCTCCTCTCGC,  downstream forward: _UP4_TAATGGAGCTTCCTGTCACA
References
27748968,29507252,31685536,34097790

72BF9B934CB5800E156263FF377DED0AD2E920A9

Page visits: 1608

Time of last update: 2022-12-01 09:35:04

Author of last update: Jstuelk