pbpF

pbpF
168

class A penicillin-binding protein 2C

locus
BSU_10110
Molecular weight
79.10 kDa
pI
7.08
Protein length
Gene length
function
bifunctional glucosyltransferase/ transpeptidase, synthesis of spore peptidoglycan
product
penicillin-binding protein 2C
essential
no
synonyms
pbpF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0744

This gene is a member of the following regulons

Gene
Coordinates
1,083,851  1,085,995
Phenotypes of a mutant
a strain lacking all four class A [wiki|penicillin-binding proteins] ([gene|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|ponA] [gene|E50D4B30C2A0987A356C988AF8A4951C0CDF6C06|pbpD] [gene|73275060537497E6A9859856C9F040763E36316B|pbpF] [gene|BDC2D775CCE7C06F5619BAC214F29CFC637FE804|pbpG]) is severely inhibited for L-form switching in the presence of D-cycloserine [pubmed|29456081]
The protein
Catalyzed reaction/ biological activity
synthesis of spore peptidoglycan (with [protein|BDC2D775CCE7C06F5619BAC214F29CFC637FE804|pbpG]) [pubmed|11567005]
[GlcNAc-(1→4)-Mur2Ac(oyl-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala)](n)-diphospho-di-trans,octa-cis-undecaprenol + β-D-GlcNAc-(1→4)-Mur2Ac(oyl-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala)-diphospho-di-trans,octa-cis-undecaprenol = [GlcNAc-(1→4)-Mur2Ac(oyl-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala)](n+1)-diphospho-di-trans-octa-cis-undecaprenol + di-trans,octa-cis-undecaprenyl diphosphate + H+ (according to UniProt)
Preferential cleavage: (Ac)(2)-L-Lys-D-Ala-|-D-Ala. Also transpeptidation of peptidyl-alanyl moieties that are N-acyl substituents of D-alanine (according to UniProt)
Protein family
N-terminal part: [wiki|glycosyltransferase 51 family] (according to UniProt)
C-terminal part: [wiki|transpeptidase family] (according to UniProt)
Structure
[PDB|2OLU] (from Staphylococcus aureus, aa 40-610, 32% identity) [pubmed|17347437]
[AF|P38050]
Paralogous protein(s)
[protein|E50D4B30C2A0987A356C988AF8A4951C0CDF6C06|pbpD], [protein|BDC2D775CCE7C06F5619BAC214F29CFC637FE804|pbpG], [protein|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|ponA]
[wiki|Localization]
cell membrane, the major part is exposed to the outside (according to UniProt)
prespore [Pubmed|15758244]
during vegetative growth: septal, low flourescence at periphery [pubmed|14731276]
Expression and Regulation
Operons
genes
[gene|73275060537497E6A9859856C9F040763E36316B|pbpF]
description
[Pubmed|1459957]
regulation
expressed in mother cell and prespore [Pubmed|15758244]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8335642], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15758244], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|73275060537497E6A9859856C9F040763E36316B|pbpF]

2023-02-04 20:48:32

ghost

23

d21478390b4ca56f762787e84fd54c0c5d9ddd17

2CFC5D31A23827DEAD26B4A7E4D86C0851FE017E

Biological materials
Mutant
BKE10110 ([gene|73275060537497E6A9859856C9F040763E36316B|pbpF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE10110 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAACTCACCTCGCCTTT,  downstream forward: _UP4_TAATGGAATTCGGCGATTTT
BKK10110 ([gene|73275060537497E6A9859856C9F040763E36316B|pbpF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK10110 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAACTCACCTCGCCTTT,  downstream forward: _UP4_TAATGGAATTCGGCGATTTT
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jeff Errington] lab
GFP fusion
2084 [gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]2 [gene|73275060537497E6A9859856C9F040763E36316B|pbpF]::pSG1491 (cat Pxyl-gfpa-[gene|73275060537497E6A9859856C9F040763E36316B|pbpF]1-335) [pubmed|14731276], available in [wiki|Dirk Jan Scheffers]' lab and in the [http://bgsc.org BGSC]
References
Reviews
33709487
Original Publications
8335642,8606187,15758244,1459957,14731276,17347437,29456081,11567005

73275060537497E6A9859856C9F040763E36316B

Page visits: 2858

Time of last update: 2023-02-05 19:05:29

Author of last update: Jstuelk