nifZ

nifZ
168

cysteine desulfurase, biosynthesis of 4-thiouridine in tRNA

locus
BSU_29590
Molecular weight
41.33 kDa
pI
6.34
Protein length
Gene length
function
biosynthesis of 4-thiouridine in tRNA
product
cysteine desulfurase
essential
no
synonyms
nifZ, iscSB, iscS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1104

This gene is a member of the following regulons

Gene
Coordinates
3,026,957  3,028,102
The protein
Catalyzed reaction/ biological activity
removes sulfuryl group from cysteine and transfers it to [protein|A64A59C2B15015F13911EC53763D370F780400FD|thiI] [Pubmed|22773787]
[sulfur carrier]-H + L-cysteine --> [sulfur carrier]-SH + L-alanine (according to UniProt)
Protein family
[wiki|Class-V pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
[wiki|Cofactors]
PLP
Structure
[PDB|1EG5] (NifS-like protein from Thermotoga maritima, 35% identity, 55% similarity) [Pubmed|10715213]
[AF|O34874]
Paralogous protein(s)
[protein|88ACE6B79534338F7C72F107B35A0B2384007088|sufS], [protein|A6746AE1B92A0CDCCB22B57B6DF78094BB0223A8|nifS], [protein|4F5945C3C8F18BD1B30D97CD516A06077C200B9D|yrvO], [protein|5424A936643C90B3DA2CB60FD0FD42A64F2BAF09|ycbU]
Expression and Regulation
Operons
genes
[gene|741DCFFBB8FF6A4E357EE5110EBE24412DE34244|nifZ]-[gene|A64A59C2B15015F13911EC53763D370F780400FD|thiI]-[gene|80B5DAED9B4BD015D877DB4819AB25FC5F165C6D|sspA]
description
[Pubmed|22383849]
Open in new tab

[gene|741DCFFBB8FF6A4E357EE5110EBE24412DE34244|nifZ]→[gene|80B5DAED9B4BD015D877DB4819AB25FC5F165C6D|sspA]

2022-11-28 15:23:06

Jstuelk

38

c96a207b604fba3a97ff9f805c130b9d09817187

28FE39136DED7BC0B197A71666940376494D0F7A

Biological materials
Mutant
BKE29590 ([gene|741DCFFBB8FF6A4E357EE5110EBE24412DE34244|nifZ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE29590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTTACTCCTTTAT,  downstream forward: _UP4_TTAAGGGAAATGATGAGGTA
BKK29590 ([gene|741DCFFBB8FF6A4E357EE5110EBE24412DE34244|nifZ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK29590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTTACTCCTTTAT,  downstream forward: _UP4_TTAAGGGAAATGATGAGGTA
References
Reviews
19348578,34201508
Original Publications
10715213,22773787

741DCFFBB8FF6A4E357EE5110EBE24412DE34244

Page visits: 1122

Time of last update: 2022-11-30 15:23:19

Author of last update: Jstuelk