SubtiWiki SubtiWiki
ydeH

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ydeH
168

unknown

locus
BSU_05200
Molecular weight
15.77 kDa
pI
9.89
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ydeH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
567,662  568,108
Expression and Regulation
Operons
genes
[gene|741F90C14739AAD2946C2DA9B315E9979A9D26E4|ydeH]
description
[Pubmed|20817675]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
Open in new tab

[gene|741F90C14739AAD2946C2DA9B315E9979A9D26E4|ydeH]

2021-06-08 00:10:26

ghost

2

0287ef368fcd0d845a0c7431f6023ae68110240a

D26566930F71ED4AFE401A711718A81942FC5E81

Biological materials
Mutant
MGNA-C131 (ydeH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2129 NBRP B. subtilis, Japan]
BKE05200 ([gene|741F90C14739AAD2946C2DA9B315E9979A9D26E4|ydeH]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05200 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTAAAGAATATGCAGTG,  downstream forward: _UP4_TAATCATCGAATTGTTATTT
BKK05200 ([gene|741F90C14739AAD2946C2DA9B315E9979A9D26E4|ydeH]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05200 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTAAAGAATATGCAGTG,  downstream forward: _UP4_TAATCATCGAATTGTTATTT
References
20817675

741F90C14739AAD2946C2DA9B315E9979A9D26E4

Page visits: 803

Time of last update: 2022-01-18 18:52:28

Author of last update: Bzhu