ybbA

ybbA
168

enterobactin esterase, release of iron from enterobactin

locus
BSU_01600
Molecular weight
21.37 kDa
pI
7.91
Protein length
Gene length
function
iron acquisition from enterobactin [pubmed|28283524]
product
enterobactin esterase [pubmed|28283524]
essential
no
synonyms
ybbA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2819

This gene is a member of the following regulons

Gene
Coordinates
179,595  180,347
The protein
Structure
[PDB|1GKL] (esterase from Clostridium thermocellum, 21% identity) [pubmed|11738044]
[AF|P55192]
Expression and Regulation
Operons
genes
[gene|516B13F337FD346B4A4A268E35D1EBABB05957E1|feuA]-[gene|57402D137E3D3791CAF0696421224F4E1DC1BA48|feuB]-[gene|F38F6D4841B3044EA0496B3A1C1D484018BDFEA4|feuC]-[gene|745167427618C4DA71848F9362043B66BC4E392E|ybbA]
description
[Pubmed|12354229]
regulation
expression during spore [wiki|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
induced by iron starvation (second wave to allow iron scavenging from the environment) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]) [pubmed|29133393]
regulatory mechanism
[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]: repression, [pubmed|12354229], in [regulon|protein:F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur regulon]
[protein|EB28A65CECE994DF2DF486DEACF40F2533703DB0|btr]: activation, in the presence of the co-activators bacillibactin or enterobactin [Pubmed|17725565], in [regulon|protein:EB28A65CECE994DF2DF486DEACF40F2533703DB0|btr regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|17725565], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
the presence of an iron-responsive element bound by [wiki|CitB] between ''[wiki|feuA]'' and ''[wiki|feuB]'' suggests iron-dependent regulation by [wiki|CitB] [Pubmed|10468622]
Open in new tab

[gene|516B13F337FD346B4A4A268E35D1EBABB05957E1|feuA]→[gene|745167427618C4DA71848F9362043B66BC4E392E|ybbA]

2022-11-25 10:00:09

Jstuelk

34

c6ed9c562a4c7db452ebc8903a1989d0bb2f0947

A3C1B309E9C3034B9896B74BA25621D2CF69902F

Other regulations
[protein|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]: translation control
Biological materials
Mutant
BKE01600 ([gene|745167427618C4DA71848F9362043B66BC4E392E|ybbA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE01600 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTGTGTTCTGAAAGAGATC,  downstream forward: _UP4_CGCTCAACCCTATGAGCGGT
BKK01600 ([gene|745167427618C4DA71848F9362043B66BC4E392E|ybbA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK01600 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTGTGTTCTGAAAGAGATC,  downstream forward: _UP4_CGCTCAACCCTATGAGCGGT
References
17725565,12354229,10468622,27766092,28283524,29133393,11738044

745167427618C4DA71848F9362043B66BC4E392E

Page visits: 2081

Time of last update: 2022-11-29 15:28:26

Author of last update: Jstuelk