ebrB

ebrB
168

multidrug efflux transporter

locus
BSU_17290
Molecular weight
12.19 kDa
pI
6.93
Protein length
Gene length
function
multidrug resistance
product
multidrug efflux transporter
essential
no
synonyms
ebrB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2076

This gene is a member of the following regulons

Gene
Coordinates
1,864,691  1,865,044
The protein
Protein family
paired small multidrug resistance  protein family ([wiki|PSMR family]) [Pubmed|17942072]
[wiki|drug/metabolite transporter (DMT) superfamily] (according to UniProt)
[wiki|Small multidrug resistance (SMR) (TC 2.A.7.1) family] (according to UniProt)
Structure
[PDB|3B5D] (EmrE from E. coli, 39% identity) [pubmed|18024586]
Paralogous protein(s)
[protein|53576746FF1B644A1980F8ACD0E8F4A54CDDAD83|ebrA]
[wiki|Localization]
cell membrane [Pubmed|17417881]
Expression and Regulation
Operons
genes
[gene|53576746FF1B644A1980F8ACD0E8F4A54CDDAD83|ebrA]-[gene|74668FF19D097722D523CC54288B6409DE267631|ebrB]
description
[Pubmed|22383849]
Open in new tab

[gene|53576746FF1B644A1980F8ACD0E8F4A54CDDAD83|ebrA]→[gene|74668FF19D097722D523CC54288B6409DE267631|ebrB]

2022-11-18 18:43:09

Jstuelk

12

ddb65f82d7a87f6f8a9432231a757050f18e5ae0

071DBC52EE4A55F2EEB2CBEC39F28E4AF9C1D504

Biological materials
Mutant
MGNA-B077 (ebrB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1076 NBRP B. subtilis, Japan]
BKE17290 ([gene|74668FF19D097722D523CC54288B6409DE267631|ebrB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE17290 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATCCTCTCATCTTCATCA,  downstream forward: _UP4_GCCTGTGAGTGACCGTCTGT
BKK17290 ([gene|74668FF19D097722D523CC54288B6409DE267631|ebrB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK17290 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATCCTCTCATCTTCATCA,  downstream forward: _UP4_GCCTGTGAGTGACCGTCTGT
References
Reviews
17942072
Original Publications
17417881,18024586

74668FF19D097722D523CC54288B6409DE267631

Page visits: 1485

Time of last update: 2022-11-27 05:30:40

Author of last update: Melvin.boenninger