

phosphoenolpyruvate carboxykinase

Molecular weight
58.13 kDa
Protein length
Gene length
synthesis of phosphoenolpyruvate
phosphoenolpyruvate carboxykinase

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1866

This gene is a member of the following regulons

3,129,530  3,131,113
The protein
Catalyzed reaction/ biological activity
ATP + oxaloacetate --> ADP + CO2 + phosphoenolpyruvate (according to UniProt)
Protein family
phosphoenolpyruvate carboxykinase (ATP) family (single member, according to UniProt)
Nucleotide binding Domain (233240)
[PDB|2PXZ] (''E.coli'')
cytoplasm (according to Swiss-Prot),  cytoplasm
Expression and Regulation
repressed by glucose (35-fold) [protein|search|CcpN] [Pubmed|15720552,12850135]
regulatory mechanism
[protein|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN]: repression, [Pubmed|15720552], in [regulon|protein:2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|15720552], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2022-11-26 06:21:55





Biological materials
1A1005 ( ''pckA''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A1005&Search=1A1005 BGSC]
1A996 ( ''pckA''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A996&Search=1A996 BGSC]
GP1147 (''pckA''::''neo''), available in [wiki|Jörg Stülke]'s lab
BKE30560 ([gene|74D4616D1A550D87182FAAC2A4AF6E04F81E1572|pckA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE30560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGAAACCTTCCTTTAT,  downstream forward: _UP4_TAAAAAACAAAAGCCAAGAG
BKK30560 ([gene|74D4616D1A550D87182FAAC2A4AF6E04F81E1572|pckA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK30560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGAAACCTTCCTTTAT,  downstream forward: _UP4_TAAAAAACAAAAGCCAAGAG
Expression vectors
pGP1753 (N-terminal Strep-tag, for [wiki|SPINE], purification from ''B. subtilis'', in [wiki|pGP380]) (available in [wiki|Jörg Stülke]'s lab) [pubmed|20933603]
pGP1762 (for expression, purification in ''E. coli'' with N-terminal His-tag, in [wiki|pWH844], available in [wiki|Jörg Stülke]'s lab)
pGP1763 (for expression, purification in ''E. coli'' with N-terminal Strep-tag, in [wiki|pGP172], available in [wiki|Jörg Stülke]'s lab)
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
FLAG-tag construct
GP1129 (spc, based on [wiki|pGP1331]), available in [wiki|Jörg Stülke]'s lab [pubmed|20933603]
lacZ fusion
pGP3312 (cat, based on [wiki|pAC5]), available in [wiki|Jörg Stülke]'s lab
GFP fusion
GP1430 (spc, based on [wiki|pGP1870]), available in [wiki|Jörg Stülke]'s lab
[wiki|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France


Page visits: 3292

Time of last update: 2022-12-01 09:24:53

Author of last update: Jstuelk