SubtiWiki SubtiWiki
pckA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

pckA
168

phosphoenolpyruvate carboxykinase

locus
BSU_30560
Molecular weight
58.13 kDa
pI
5.12
Protein length
Gene length
function
synthesis of phosphoenolpyruvate
product
phosphoenolpyruvate carboxykinase
essential
no
ec
4.1.1.49
synonyms
pckA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1866

This gene is a member of the following regulons

Gene
Coordinates
3,129,530  3,131,113
The protein
Catalyzed reaction/ biological activity
ATP + oxaloacetate --> ADP + CO2 + phosphoenolpyruvate (according to UniProt)
Protein family
phosphoenolpyruvate carboxykinase (ATP) family (single member, according to UniProt)
[wiki|Domains]
Nucleotide binding Domain (233240)
Structure
[PDB|2PXZ] (''E.coli'')
[wiki|Localization]
cytoplasm (according to Swiss-Prot),  cytoplasm
Expression and Regulation
Operons
genes
[gene|74D4616D1A550D87182FAAC2A4AF6E04F81E1572|pckA]
description
[Pubmed|9387221]
regulation
repressed by glucose (35-fold) [protein|search|CcpN] [Pubmed|15720552,12850135]
regulatory mechanism
[protein|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN]: repression, [Pubmed|15720552], in [regulon|protein:2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|15720552], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|74D4616D1A550D87182FAAC2A4AF6E04F81E1572|pckA]

2022-01-28 00:13:28

ghost

9

c51496c43c3d7c242b6ec156cd659276ffd6d4b4

709069FD604114640A936EAD2D10F54B494E230C

Biological materials
Mutant
1A1005 ( ''pckA''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A1005&Search=1A1005 BGSC]
1A996 ( ''pckA''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A996&Search=1A996 BGSC]
GP1147 (''pckA''::''neo''), available in [wiki|Jörg Stülke]'s lab
BKE30560 ([gene|74D4616D1A550D87182FAAC2A4AF6E04F81E1572|pckA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGAAACCTTCCTTTAT,  downstream forward: _UP4_TAAAAAACAAAAGCCAAGAG
BKK30560 ([gene|74D4616D1A550D87182FAAC2A4AF6E04F81E1572|pckA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGAAACCTTCCTTTAT,  downstream forward: _UP4_TAAAAAACAAAAGCCAAGAG
Expression vectors
pGP1753 (N-terminal Strep-tag, for [wiki|SPINE], purification from ''B. subtilis'', in [wiki|pGP380]) (available in [wiki|Jörg Stülke]'s lab) [pubmed|20933603]
pGP1762 (for expression, purification in ''E. coli'' with N-terminal His-tag, in [wiki|pWH844], available in [wiki|Jörg Stülke]'s lab)
pGP1763 (for expression, purification in ''E. coli'' with N-terminal Strep-tag, in [wiki|pGP172], available in [wiki|Jörg Stülke]'s lab)
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
FLAG-tag construct
GP1129 (spc, based on [wiki|pGP1331]), available in [wiki|Jörg Stülke]'s lab [pubmed|20933603]
lacZ fusion
pGP3312 (cat, based on [wiki|pAC5]), available in [wiki|Jörg Stülke]'s lab
GFP fusion
GP1430 (spc, based on [wiki|pGP1870]), available in [wiki|Jörg Stülke]'s lab
labs
[wiki|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
References
12850135,15720552,18586936,9387221,20933603,22190493,23136871

74D4616D1A550D87182FAAC2A4AF6E04F81E1572

Page visits: 2525

Time of last update: 2022-01-28 02:01:38

Author of last update: Jstuelk