yozQ

yozQ
168

unknown

locus
BSU_18600
Molecular weight
11.03 kDa
pI
4.21
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yozQ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5876

This gene is a member of the following regulons

Gene
Coordinates
2,029,020  2,029,313
The protein
Structure
[AF|Q7WY68]
Expression and Regulation
Operons
genes
[gene|74E4889419A396A6976D752CE5914A9A5ADCCCA4|yozQ]
description
[Pubmed|16497325]
regulation
expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|74E4889419A396A6976D752CE5914A9A5ADCCCA4|yozQ]

2022-12-13 23:16:22

ghost

16

2c41e756e1f1cc5931ea685a376a806b203fee04

7FB9F9808C98040C9AE1758E5876E24C5E0EAD0E

additional information
the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
Biological materials
Mutant
BKE18600 ([gene|74E4889419A396A6976D752CE5914A9A5ADCCCA4|yozQ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE18600 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTTACTTCCTCCAGATT,  downstream forward: _UP4_TAGCCATACAAACGGAACTA
BKK18600 ([gene|74E4889419A396A6976D752CE5914A9A5ADCCCA4|yozQ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK18600 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTTACTTCCTCCAGATT,  downstream forward: _UP4_TAGCCATACAAACGGAACTA
References
16497325,30782632

74E4889419A396A6976D752CE5914A9A5ADCCCA4

Page visits: 872

Time of last update: 2023-02-03 21:28:45

Author of last update: Melvin.boenninger