braB

braB
168

branched-chain amino acid transporter

locus
BSU_29600
Molecular weight
46.45 kDa
pI
9.65
Protein length
Gene length
function
uptake of branched-chain amino acids
product
branched-chain amino acid transporter
essential
no
synonyms
braB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1114

This gene is a member of the following regulons

Gene
Coordinates
3,028,297  3,029,634
Phenotypes of a mutant
no phenotype for the single mutant, the triple ''[gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP] [gene|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|brnQ] [gene|75A874F0C344E8404BE39C32EFF59CE562193640|braB]'' mutant is strongly impaired in the transport of isoleucine and valine at low concentrations [Pubmed|25645558]
The protein
Catalyzed reaction/ biological activity
high affinity uptake of isoleucine and valine [Pubmed|25645558]
Protein family
branched chain amino acid transporter family (together with [protein|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|brnQ]) (according to UniProt)
Structure
[AF|O34545]
Paralogous protein(s)
[protein|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|brnQ]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|75A874F0C344E8404BE39C32EFF59CE562193640|braB]
description
[Pubmed|9387221]
regulation
induced in the absence of branched-chain amino acids ([wiki|CodY], [wiki|ScoC]) [Pubmed|26473603]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|26473603], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]: repression, [Pubmed|26473603], in [regulon|protein:F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|26473603], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
note that [wiki|CodY] represses the expression of ''[protein|search|scoC]'', therefore ''[protein|search|braB]'' expression is increased at intermediate levels of [wiki|CodY] activity [Pubmed|26473603]
Open in new tab

[gene|75A874F0C344E8404BE39C32EFF59CE562193640|braB]

2022-11-24 06:18:58

ghost

18

a63c26a97305f6dd3bd0bd766f1aca47d9e5ac90

88DBE4F87953F4F89A194D49798AA7C090484333

Biological materials
Mutant
GP4152 (Δ[gene|75A874F0C344E8404BE39C32EFF59CE562193640|braB]::''aphA3''), available in [wiki|Jörg Stülke]'s lab
GP4157 (Δ[gene|75A874F0C344E8404BE39C32EFF59CE562193640|braB]::''aphA3'', Δ[gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP]::''ermC''), available in [wiki|Jörg Stülke]'s lab
BKE29600 ([gene|75A874F0C344E8404BE39C32EFF59CE562193640|braB]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE29600 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAAAAAAATCCTCCTAA,  downstream forward: _UP4_TAATGTCACAGAACGCCTGC
BKK29600 ([gene|75A874F0C344E8404BE39C32EFF59CE562193640|braB]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK29600 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAAAAAAATCCTCCTAA,  downstream forward: _UP4_TAATGTCACAGAACGCCTGC
References
9387221,25645558,26473603

75A874F0C344E8404BE39C32EFF59CE562193640

Page visits: 2968

Time of last update: 2022-12-06 23:45:13

Author of last update: Jstuelk