htrC

htrC
168

similar to quality control membrane serine protease [protein|76FA52D5A5F9FCA14BA9B45872FE3D99D89B211B|htrA]

locus
BSU_40360
Molecular weight
42.63 kDa
pI
5.32
Protein length
Gene length
function
unknown
product
putative quality control membrane protease
essential
no
synonyms
htrC, yycK, yyxA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0265

This gene is a member of the following regulons

Gene
Coordinates
4,147,567  4,148,769
The protein
Protein family
Peptidase S1C family (with [protein|76FA52D5A5F9FCA14BA9B45872FE3D99D89B211B|htrA] and [protein|796216BE9CD6DADFEADC29497253C81BF496A2ED|htrB], according to UniProt)
[wiki|Domains]
transmembrane helix (aa 22 - 42) (according to UniProt)
[wiki|PDZ domain] (aa 295 - 392) (according to UniProt)
Structure
[PDB|3QO6] (from Arabidopsis thaliana, 37% identity) [pubmed|21532594]
[AF|P39668]
Paralogous protein(s)
[protein|76FA52D5A5F9FCA14BA9B45872FE3D99D89B211B|htrA]
[wiki|Localization]
inner spore membrane [Pubmed|26731423]
Expression and Regulation
Operons
genes
[gene|75B8C37E589C855D2BAD7FB51B9600E161ACFBD3|htrC]
description
[Pubmed|9829949]
regulation
''htrC'' transcript expressed during sporulation [Pubmed|9829949]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|9829949], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|75B8C37E589C855D2BAD7FB51B9600E161ACFBD3|htrC]

2023-01-27 22:01:44

ghost

43

45f179424eaf87ac0d6bda1f2a499b80f45fef39

0069251A7097D92072A0DB630E648B98006D50C6

genes
[gene|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|walR]-[gene|E88978809272FAC2520DB4ABCA0554F8028F3451|walK]-[gene|06D2D03C65D50E3909B2C93835193815B6016967|walH]-[gene|EE681C9A42FCC29CBB55CC9566EE4CFF986D0F1D|walI]-[gene|D5321F707E183E72B225F1CED2F2FDCB1183B88A|walJ]-[gene|75B8C37E589C855D2BAD7FB51B9600E161ACFBD3|htrC]
description
[Pubmed|9829949]
regulation
''htrC'' transcript expressed during sporulation [Pubmed|9829949]
Open in new tab

[gene|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|walR]→[gene|75B8C37E589C855D2BAD7FB51B9600E161ACFBD3|htrC]

2023-01-30 23:09:54

ghost

63

4e891bb3dceb8eda2e5ad4f9ed646a611afbe349

32BB8D419E54714C8925B07FBBCF691251CA4145

Biological materials
Mutant
MGNA-B823 (yycK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1822 NBRP B. subtilis, Japan]
BKE40360 ([gene|75B8C37E589C855D2BAD7FB51B9600E161ACFBD3|htrC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE40360 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTCCATCCTTTCCAAG,  downstream forward: _UP4_TAATAAAAGCAGTCTGGCAT
BKK40360 ([gene|75B8C37E589C855D2BAD7FB51B9600E161ACFBD3|htrC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK40360 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTCCATCCTTTCCAAG,  downstream forward: _UP4_TAATAAAAGCAGTCTGGCAT
References
Reviews
21326199,34410368
Original Publications
17600057,12270824,11555295,18957862,10692364,21624103,22307758,22092710,24362423,9829949,21630458,24115457,25384476,26731423,21532594

75B8C37E589C855D2BAD7FB51B9600E161ACFBD3

Page visits: 2636

Time of last update: 2023-02-07 07:36:06

Author of last update: Jstuelk