ydaS

ydaS
168

general stress protein

locus
BSU_04370
Molecular weight
8.51 kDa
pI
12.19
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ydaS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2261

This gene is a member of the following regulons

Gene
Coordinates
492,654  492,911
The protein
Protein family
UPF0410 family (with [protein|050A2F1399C2B0831A24623867875BFEBD02AA71|ywzA], according to UniProt)
Structure
[AF|P96594]
Expression and Regulation
Operons
genes
[gene|7601A53CE6A8AD417AADBED3199DB46B285D9059|ydaS]
description
[Pubmed|10482513]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|10482513], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|7601A53CE6A8AD417AADBED3199DB46B285D9059|ydaS]

2022-11-28 22:19:09

ghost

20

19be80e465b8325abc0ea3717f6a8530d3e0e283

5E73228105D4747B4CB76E392FA07A359F7E6D65

genes
[gene|E30C92E8D0CC56F7406B87B7EA25B7C41086DD73|ydaT]-[gene|7601A53CE6A8AD417AADBED3199DB46B285D9059|ydaS]
description
[Pubmed|10482513]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|10482513], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|E30C92E8D0CC56F7406B87B7EA25B7C41086DD73|ydaT]→[gene|7601A53CE6A8AD417AADBED3199DB46B285D9059|ydaS]

2022-11-23 14:32:22

ghost

15

8f6a8fdcac7e8725a126c926fdc234fc5a1d1bfc

BC3B508E35D6FCBE443A28317A140285F3F65320

Biological materials
Mutant
MGNA-C112 (ydaS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2110 NBRP B. subtilis, Japan]
BKE04370 ([gene|7601A53CE6A8AD417AADBED3199DB46B285D9059|ydaS]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04370 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCATGATCACCTCTCATA,  downstream forward: _UP4_TAGACTCATTAGATACAGGA
BKK04370 ([gene|7601A53CE6A8AD417AADBED3199DB46B285D9059|ydaS]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04370 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCATGATCACCTCTCATA,  downstream forward: _UP4_TAGACTCATTAGATACAGGA
References
15805528,10482513

7601A53CE6A8AD417AADBED3199DB46B285D9059

Page visits: 1333

Time of last update: 2022-11-29 08:15:04

Author of last update: Melvin.boenninger