iolA

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

iolA
168

methylmalonate-semialdehyde dehydrogenase (acylating)

locus
BSU_39760
Molecular weight
53.29 kDa
pI
5.14
Protein length
Gene length
function
myo-inositol catabolism
product
methylmalonate-semialdehyde dehydrogenase (acylating)
essential
no
ec
1.2.1.27
synonyms
iolA, mmsA, yxdA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1012

This gene is a member of the following regulons

Gene
Coordinates
4,082,920  4,084,383
The protein
Catalyzed reaction/ biological activity
NAD-dependent oxidation of methylmalonate semialdehyde (MMSA) to propionyl-CoA via acylation and deacylation steps
3-oxopropanoate + CoA + NAD+ --> acetyl-CoA + CO2 + NADH (according to UniProt)
2-methyl-3-oxopropanoate + CoA + H2O + NAD+ --> H+ + hydrogencarbonate + NADH + propanoyl-CoA (according to UniProt)
Protein family
[wiki|aldehyde dehydrogenase family] (according to UniProt)
[wiki|Cofactors]
Coenzyme A, NAD [Pubmed|22782904]
Structure
[PDB|1T90]\t [Pubmed|22782904]
[AF|P42412]
Paralogous protein(s)
[protein|99F1FAF28FB4817D94E84BD5288FA33124558933|ywdH], [protein|A0BEB92D54799956A4ADE106A1388E5710141069|gabD], [protein|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|yfmT], [protein|F3341F205CB939498109D2A54DE842065C488DD5|aldX], [protein|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|aldY], [protein|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|gbsA], [protein|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC], [protein|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|ycbD], [protein|67A72A0EABCD807C25D8EAC61C251142B45C174E|dhaS], [protein|69838717DC6BB27864D88C282BF5BC7CC558BFD7|rocA]
Expression and Regulation
Operons
genes
[gene|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA]-[gene|0903CCBE053230998A9123F3269868E952C0F76B|iolB]-[gene|AAE60753464EAA32379521531FDCAF64534D5F40|iolC]-[gene|AA79B6F039EC5B79F4419A5F358AE5AE8292E731|iolD]-[gene|C31AF6C8050D453D9011B0793403791F1851BA69|iolE]-[gene|14813DE6C6DF7AB031BA05AED7D31AE9E8F8498E|iolF]-[gene|93C1DF93CAFC5AE726523A91A3BA7470017FF6DC|iolG]-[gene|FD64E9D00BB03B510C7F7CA3935558A2195532A9|iolH]-[gene|2742FCE60AA87B2BE5A0B5C34F617E10DDE7F126|iolI]-[gene|1EFB5C8F28146D1EA3B615F548D0CF262D2B4DF5|iolJ]
description
[Pubmed|9226270]
regulation
induced by inositol ([protein|search|IolR]) [Pubmed|9887260,9226270]
regulatory mechanism
[protein|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR]: repression, [Pubmed|9887260,9226270], in [regulon|protein:5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|10666464], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9226270], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA]→[gene|1EFB5C8F28146D1EA3B615F548D0CF262D2B4DF5|iolJ]

2022-05-22 16:37:58

ghost

22

4fd092965338ef1511600132442d2247a2693c98

C19E63046F0B412961D2626F72E0308D922D50B2

Biological materials
Mutant
MGNA-B770 (iolA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1769 NBRP B. subtilis, Japan]
BKE39760 ([gene|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39760 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTTATTGCCTCCTTCA,  downstream forward: _UP4_TAAACGACGAACAGCCGAAC
BKK39760 ([gene|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39760 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTTATTGCCTCCTTCA,  downstream forward: _UP4_TAAACGACGAACAGCCGAAC
labs
[wiki|Yasutaro Fujita], University of Fukuyama, Japan
[[Ken-ichi Yoshida]], Kobe University, Japan
References
9226270,11566986,10666464,18310071,9887260,9887260,18310071,16332250,22900538

762718A15E5256261D79DF60F9106AF0CE2D60C6

Page visits: 1882

Time of last update: 2022-05-24 20:30:34

Author of last update: Melvin.boenninger