

glycine betaine/carnitine/choline/arsenobetaine/arsenocholine [wiki|ABC transporter]

Molecular weight
24.40 kDa
Protein length
Gene length
compatible solute transport
glycine betaine/carnitine/choline/arsenobetaine/arsenocholine [wiki|ABC transporter]
opuCD, yvbB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1174

This gene is a member of the following regulons

3,467,546  3,468,235
The protein
Catalyzed reaction/ biological activity
uptake of glycine betaine, arsenocholine and arsenobetaine [pubmed|29159878]
Protein family
[wiki|Binding-protein-dependent transport system permease family] (according to UniProt)
[wiki|CysTW subfamily] (according to UniProt)
[wiki|ABC transmembrane type-1 domain] (aa 22-202) (according to UniProt)
Paralogous protein(s)
cell membrane [Pubmed|10092453]
Expression and Regulation
induced by salt stress [Pubmed|23960087,10216873]
induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|ylxR] [pubmed|30355672]
regulatory mechanism
[protein|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|opcR]: repression, (sterical interference with RNA polymerase access) [Pubmed|32849357,23960087], in [regulon|protein:9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|opcR regulon]
[protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]: activation, [Pubmed|23646920], in [regulon|protein:6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA regulon]
[protein|F4097349A563503468A2A14F062AEAC532C7917A|ylxR]: unknown, [pubmed|30355672], in [regulon|protein:F4097349A563503468A2A14F062AEAC532C7917A|ylxR regulon]
Open in new tab


2022-11-27 03:16:39





Biological materials
BKE33800 ([gene|76C8D6BF2CA1FA5E7392C52FFD55FD01EF5AB9DC|opuCD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE33800 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTCCATATGATCCACCTCTT,  downstream forward: _UP4_TAAATACAACAGAGGTGGTT
BKK33800 ([gene|76C8D6BF2CA1FA5E7392C52FFD55FD01EF5AB9DC|opuCD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK33800 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTCCATATGATCCACCTCTT,  downstream forward: _UP4_TAAATACAACAGAGGTGGTT
Original Publications


Page visits: 1177

Time of last update: 2022-12-02 04:30:44

Author of last update: Melvin.boenninger