htrA

htrA
168

membrane-anchored protein quality control protease, serine protease Do

locus
BSU_12900
Molecular weight
47.55 kDa
pI
4.7
Protein length
Gene length
function
protein quality control
product
serine protease Do
essential
no
synonyms
htrA, ykdA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0265

This gene is a member of the following regulons

Gene
Coordinates
1,357,936  1,359,285
The protein
Catalyzed reaction/ biological activity
required for folding of the secreted protein [protein|6EA4D86FA1EA6388054A4D863EB576187CD5AEEE|yqxI] [Pubmed|23937099]
Acts on substrates that are at least partially unfolded. The cleavage site P1 residue is normally between a pair of hydrophobic residues, such as Val-|-Val (according to UniProt)
Protein family
Peptidase S1C family (with [protein|796216BE9CD6DADFEADC29497253C81BF496A2ED|htrB] and [protein|75B8C37E589C855D2BAD7FB51B9600E161ACFBD3|htrC], according to UniProt)
[wiki|Domains]
cytoplasmic domain (aa 1 - 44) (according to UniProt)
transmembrane helix (aa 45 - 67) (according to UniProt)
extracellular domain (aa 68 - 479) (according to UniProt)
[wiki|PDZ domain] (aa 342 - 441) (according to UniProt)
Structure
[PDB|3QO6] (from Arabidopsis thaliana, 37% identity) [pubmed|21532594]
[AF|O34358]
Paralogous protein(s)
[protein|75B8C37E589C855D2BAD7FB51B9600E161ACFBD3|htrC]
[wiki|Localization]
cell membrane (according to Swiss-Prot)
extracellular (signal peptide) [Pubmed|18957862]
randomly distributed in foci throughout the cell surface [Pubmed|22307758]
Expression and Regulation
Operons
genes
[gene|76FA52D5A5F9FCA14BA9B45872FE3D99D89B211B|htrA]
description
[pubmed|22383849]
regulation
expressed under conditions of secretion stress ([protein|A40CD2C23A19860342F440284302EFFDAC09E88A|cssR]) [Pubmed|11555295]
regulatory mechanism
[protein|A40CD2C23A19860342F440284302EFFDAC09E88A|cssR]: activation, [Pubmed|11555295], in [regulon|protein:A40CD2C23A19860342F440284302EFFDAC09E88A|cssR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10692364], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
[protein|76FA52D5A5F9FCA14BA9B45872FE3D99D89B211B|htrA] is subject to degradation by [protein|DC0FDCA3FA6742B023E6877CE9554AA1D47012BB|wprA] and other extracellular proteases [PubMed|24362423]
Open in new tab

[gene|76FA52D5A5F9FCA14BA9B45872FE3D99D89B211B|htrA]

2022-12-29 12:37:49

Jstuelk

38

a9cc0e9abb9b736200068746a7efd4b47300458b

BECBBF118DFA947DDC236F0E3AD7B6178EDDD8C8

Biological materials
Mutant
1A933 (no resistance), [Pubmed|10692364], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A933&Search=1A933 BGSC]
BKE12900 ([gene|76FA52D5A5F9FCA14BA9B45872FE3D99D89B211B|htrA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE12900 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCATGTTCACTCCGTTTC,  downstream forward: _UP4_TAAGACATAATGCCTCAGGC
BKK12900 ([gene|76FA52D5A5F9FCA14BA9B45872FE3D99D89B211B|htrA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK12900 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCATGTTCACTCCGTTTC,  downstream forward: _UP4_TAAGACATAATGCCTCAGGC
References
Reviews
22688815,21326199,25212246,31001739,34410368
Original Publications
17600057,12270824,11555295,18957862,10692364,21624103,22307758,22092710,24362423,23937099,24115457,11133960,21532594,32111210

76FA52D5A5F9FCA14BA9B45872FE3D99D89B211B

Page visits: 4801

Time of last update: 2023-02-02 09:07:18

Author of last update: Jstuelk